nab package

Submodules

nab.nab_build_dna_structure module

Module containing the NabBuildDNAStructure class and the command line interface.

class nab.nab_build_dna_structure.NabBuildDNAStructure(output_pdb_path, properties, **kwargs)[source]

Bases: biobb_common.generic.biobb_object.BiobbObject

biobb_amber.nab.nab_build_dna_structure NabBuildDNAStructure
Builds a 3D structure from a DNA sequence using nab (Nucleic Acid Builder) tool from the AmberTools MD package.
Parameters
  • output_pdb_path (str) – DNA 3D structure PDB file. File type: output. Sample file. Accepted formats: pdb (edam:format_1476).

  • properties (dic - Python dictionary object containing the tool parameters, not input/output files) –

    • sequence (str) - (“GCGCGGCTGATAAACGAAAGC”) Nucleotide sequence to convert to a 3D structure. Nucleotides should be written in 1-letter code, with no spaces between them.

    • helix_type (str) - (“lbdna”) DNA/RNA helix type. Values: arna (Right Handed A-RNA - Arnott), aprna (Right Handed A’-RNA - Arnott), lbdna (Right Handed B-DNA - Langridge), abdna (Right Handed B-DNA - Arnott), sbdna (Left Handed B-DNA - Sasisekharan), adna (Right Handed A-DNA - Arnott).

    • compiler (str) - (“gcc”) Alternative C compiler for nab.

    • linker (str) - (“gfortran”) Alternative Fortran linker for nab.

    • remove_tmp (bool) - (True) [WF property] Remove temporal files.

    • restart (bool) - (False) [WF property] Do not execute if output files exist.

Examples

This is a use example of how to use the building block from Python:

from biobb_amber.nab.nab_build_dna_structure import nab_build_dna_structure
prop = {
    'sequence': 'GCGCGGCTGATAAACGAAAGC'
}
nab_build_dna_structure(output_pdb_path='/path/to/newStructure.pdb',
                        properties=prop)
Info:
check_data_params(out_log, err_log)[source]

Checks input/output paths correctness

launch()[source]

Launches the execution of the NabBuildDNAStructure module.

nab.nab_build_dna_structure.main()[source]
nab.nab_build_dna_structure.nab_build_dna_structure(output_pdb_path: str, properties: Optional[dict] = None, **kwargs) int[source]

Create NabBuildDNAStructure method