nab package

Submodules

nab.nab_build_dna_structure module

Module containing the NabBuildDNAStructure class and the command line interface.

class nab.nab_build_dna_structure.NabBuildDNAStructure(output_pdb_path, properties, **kwargs)

Bases: BiobbObject

biobb_amber.nab.nab_build_dna_structure NabBuildDNAStructure

Wrapper of the AmberTools (AMBER MD Package) nab tool module.

Builds a 3D structure from a DNA sequence using nab (Nucleic Acid Builder) tool from the AmberTools MD package.

Parameters:

• output_pdb_path (str) – DNA 3D structure PDB file. File type: output. Sample file. Accepted formats: pdb (edam:format_1476).

• properties (dic - Python dictionary object containing the tool parameters, not input/output files) –

  • sequence (str) - (“GCGCGGCTGATAAACGAAAGC”) Nucleotide sequence to convert to a 3D structure. Nucleotides should be written in 1-letter code, with no spaces between them.

  • helix_type (str) - (“lbdna”) DNA/RNA helix type. Values: arna (Right Handed A-RNA - Arnott), aprna (Right Handed A’-RNA - Arnott), lbdna (Right Handed B-DNA - Langridge), abdna (Right Handed B-DNA - Arnott), sbdna (Left Handed B-DNA - Sasisekharan), adna (Right Handed A-DNA - Arnott).

  • compiler (str) - (“gcc”) Alternative C compiler for nab.

  • linker (str) - (“gfortran”) Alternative Fortran linker for nab.

  • binary_path (str) - (“nab”) Path to the nab executable binary.

  • remove_tmp (bool) - (True) [WF property] Remove temporal files.

  • restart (bool) - (False) [WF property] Do not execute if output files exist.

  • container_path (str) - (None) Container path definition.

  • container_image (str) - (‘afandiadib/ambertools:serial’) Container image definition.

  • container_volume_path (str) - (‘/tmp’) Container volume path definition.

  • container_working_dir (str) - (None) Container working directory definition.

  • container_user_id (str) - (None) Container user_id definition.

  • container_shell_path (str) - (‘/bin/bash’) Path to default shell inside the container.

Examples

This is a use example of how to use the building block from Python:

from biobb_amber.nab.nab_build_dna_structure import nab_build_dna_structure
prop = {
    'sequence': 'GCGCGGCTGATAAACGAAAGC'
}
nab_build_dna_structure(output_pdb_path='/path/to/newStructure.pdb',
                        properties=prop)

Info:

• wrapped_software:

  • name: AmberTools nab

  • version: >20.9

  • license: LGPL 2.1

• ontology:

  • name: EDAM

  • schema: http://edamontology.org/EDAM.owl

check_data_params(out_log, err_log)

Checks input/output paths correctness

launch()

Launches the execution of the NabBuildDNAStructure module.

nab.nab_build_dna_structure.main()

nab.nab_build_dna_structure.nab_build_dna_structure(output_pdb_path: str, properties: dict | None = None, **kwargs) → int

Create NabBuildDNAStructure method