#!/usr/bin/env python3
"""Module containing the NabBuildDNAStructure class and the command line interface."""
import argparse
from pathlib import PurePath
from biobb_common.generic.biobb_object import BiobbObject
from biobb_common.configuration import settings
from biobb_common.tools import file_utils as fu
from biobb_common.tools.file_utils import launchlogger
from biobb_amber.nab.common import check_output_path
[docs]class NabBuildDNAStructure(BiobbObject):
"""
| biobb_amber.nab.nab_build_dna_structure NabBuildDNAStructure
| Wrapper of the `AmberTools (AMBER MD Package) nab tool <https://ambermd.org/AmberTools.php>`_ module.
| Builds a 3D structure from a DNA sequence using nab (Nucleic Acid Builder) tool from the AmberTools MD package.
Args:
output_pdb_path (str): DNA 3D structure PDB file. File type: output. `Sample file <https://github.com/bioexcel/biobb_amber/raw/master/biobb_amber/test/reference/nab/ref_nab_build_dna_structure.pdb>`_. Accepted formats: pdb (edam:format_1476).
properties (dic - Python dictionary object containing the tool parameters, not input/output files):
* **sequence** (*str*) - ("GCGCGGCTGATAAACGAAAGC") Nucleotide sequence to convert to a 3D structure. Nucleotides should be written in 1-letter code, with no spaces between them.
* **helix_type** (*str*) - ("lbdna") DNA/RNA helix type. Values: arna (Right Handed A-RNA - Arnott), aprna (Right Handed A’-RNA - Arnott), lbdna (Right Handed B-DNA - Langridge), abdna (Right Handed B-DNA - Arnott), sbdna (Left Handed B-DNA - Sasisekharan), adna (Right Handed A-DNA - Arnott).
* **compiler** (*str*) - ("gcc") Alternative C compiler for nab.
* **linker** (*str*) - ("gfortran") Alternative Fortran linker for nab.
* **binary_path** (*str*) - ("nab") Path to the nab executable binary.
* **remove_tmp** (*bool*) - (True) [WF property] Remove temporal files.
* **restart** (*bool*) - (False) [WF property] Do not execute if output files exist.
* **container_path** (*str*) - (None) Container path definition.
* **container_image** (*str*) - ('afandiadib/ambertools:serial') Container image definition.
* **container_volume_path** (*str*) - ('/tmp') Container volume path definition.
* **container_working_dir** (*str*) - (None) Container working directory definition.
* **container_user_id** (*str*) - (None) Container user_id definition.
* **container_shell_path** (*str*) - ('/bin/bash') Path to default shell inside the container.
Examples:
This is a use example of how to use the building block from Python::
from biobb_amber.nab.nab_build_dna_structure import nab_build_dna_structure
prop = {
'sequence': 'GCGCGGCTGATAAACGAAAGC'
}
nab_build_dna_structure(output_pdb_path='/path/to/newStructure.pdb',
properties=prop)
Info:
* wrapped_software:
* name: AmberTools nab
* version: >20.9
* license: LGPL 2.1
* ontology:
* name: EDAM
* schema: http://edamontology.org/EDAM.owl
"""
def __init__(self, output_pdb_path, properties, **kwargs):
properties = properties or {}
# Call parent class constructor
super().__init__(properties)
self.locals_var_dict = locals().copy()
# Input/Output files
self.io_dict = {
'in': {},
'out': {'output_pdb_path': output_pdb_path}
}
# Properties specific for BB
self.properties = properties
self.sequence = properties.get('sequence', "GCGCGGCTGATAAACGAAAGC")
self.helix_type = properties.get('helix_type', "lbdna")
self.compiler = properties.get('compiler', "gcc")
self.linker = properties.get('linker', "gfortran")
self.binary_path = properties.get('binary_path', 'nab')
# Check the properties
self.check_properties(properties)
self.check_arguments()
[docs] def check_data_params(self, out_log, err_log):
""" Checks input/output paths correctness """
# Check output(s)
self.io_dict["out"]["output_pdb_path"] = check_output_path(self.io_dict["out"]["output_pdb_path"], "output_pdb_path", False, out_log, self.__class__.__name__)
[docs] @launchlogger
def launch(self):
"""Launches the execution of the NabBuildDNAStructure module."""
# check input/output paths and parameters
self.check_data_params(self.out_log, self.err_log)
# Setup Biobb
if self.check_restart():
return 0
self.stage_files()
# Creating temporary folder
# self.tmp_folder = fu.create_unique_dir()
# fu.log('Creating %s temporary folder' % self.tmp_folder, self.out_log)
# create .nab file
# molecule m;
# m = fd_helix( "abdna", "aaaaaaaaaa", "dna" );
# putpdb( "nuc.pdb", m, "-wwpdb");
acid_type = 'dna'
if ("rna" in self.helix_type):
acid_type = 'rna'
# Creating temporary folder & Leap configuration (instructions) file
if self.container_path:
instructions_file = str(PurePath(self.stage_io_dict['unique_dir']).joinpath("nuc.nab"))
instructions_file_path = str(PurePath(self.container_volume_path).joinpath("nuc.nab"))
self.tmp_folder = None
else:
self.tmp_folder = fu.create_unique_dir()
instructions_file = str(PurePath(self.tmp_folder).joinpath("nuc.nab"))
fu.log('Creating %s temporary folder' % self.tmp_folder, self.out_log)
instructions_file_path = instructions_file
# instructions_file = str(PurePath(self.tmp_folder).joinpath("nuc.nab"))
with open(instructions_file, 'w') as nabin:
nabin.write("molecule m; \n")
nabin.write("m = fd_helix( \"" + self.helix_type + "\", \"" + self.sequence + "\", \"" + acid_type + "\" ); \n")
nabin.write("putpdb( \"" + self.stage_io_dict['out']['output_pdb_path'] + "\" , m, \"-wwpdb\");\n")
# Command line
if self.container_path:
nuc_path = self.container_volume_path
self.cmd = [self.binary_path,
'--compile', self.compiler,
'-Xlinker', self.linker,
instructions_file_path,
' ; ' + nuc_path + '/nuc'
]
else:
nuc_path = './' + self.tmp_folder
self.cmd = [self.binary_path,
'--compiler', self.compiler,
'--linker', self.linker,
instructions_file_path,
' ; ' + nuc_path + '/nuc'
]
# Run Biobb block
self.run_biobb()
# Copy files to host
self.copy_to_host()
# remove temporary folder(s)
self.tmp_files.extend([
self.stage_io_dict.get("unique_dir"),
self.tmp_folder,
"nab.log",
"tleap.out"
])
self.remove_tmp_files()
self.check_arguments(output_files_created=True, raise_exception=False)
return self.return_code
[docs]def nab_build_dna_structure(output_pdb_path: str,
properties: dict = None, **kwargs) -> int:
"""Create :class:`NabBuildDNAStructure <nab.nab_build_dna_structure.NabBuildDNAStructure>`nab.nab_build_dna_structure.NabBuildDNAStructure class and
execute :meth:`launch() <nab.nab_build_dna_structure.NabBuildDNAStructure.launch>` method"""
return NabBuildDNAStructure(output_pdb_path=output_pdb_path,
properties=properties).launch()
[docs]def main():
parser = argparse.ArgumentParser(description='Building a 3D structure from a DNA sequence using nab.', formatter_class=lambda prog: argparse.RawTextHelpFormatter(prog, width=99999))
parser.add_argument('--config', required=False, help='Configuration file')
# Specific args
required_args = parser.add_argument_group('required arguments')
required_args.add_argument('--output_pdb_path', required=True, help='Linear (unfolded) 3D structure PDB file. Accepted formats: pdb.')
args = parser.parse_args()
config = args.config if args.config else None
properties = settings.ConfReader(config=config).get_prop_dic()
# Specific call
nab_build_dna_structure(output_pdb_path=args.output_pdb_path,
properties=properties)
if __name__ == '__main__':
main()