Source code for nab.nab_build_dna_structure

#!/usr/bin/env python3

"""Module containing the NabBuildDNAStructure class and the command line interface."""
import argparse
from pathlib import PurePath
from biobb_common.generic.biobb_object import BiobbObject
from biobb_common.configuration import settings
from biobb_common.tools import file_utils as fu
from biobb_common.tools.file_utils import launchlogger
from biobb_amber.nab.common import check_output_path


[docs]class NabBuildDNAStructure(BiobbObject): """ | biobb_amber.nab.nab_build_dna_structure NabBuildDNAStructure | Wrapper of the `AmberTools (AMBER MD Package) nab tool <https://ambermd.org/AmberTools.php>`_ module. | Builds a 3D structure from a DNA sequence using nab (Nucleic Acid Builder) tool from the AmberTools MD package. Args: output_pdb_path (str): DNA 3D structure PDB file. File type: output. `Sample file <https://github.com/bioexcel/biobb_amber/raw/master/biobb_amber/test/reference/nab/ref_nab_build_dna_structure.pdb>`_. Accepted formats: pdb (edam:format_1476). properties (dic - Python dictionary object containing the tool parameters, not input/output files): * **sequence** (*str*) - ("GCGCGGCTGATAAACGAAAGC") Nucleotide sequence to convert to a 3D structure. Nucleotides should be written in 1-letter code, with no spaces between them. * **helix_type** (*str*) - ("lbdna") DNA/RNA helix type. Values: arna (Right Handed A-RNA - Arnott), aprna (Right Handed A’-RNA - Arnott), lbdna (Right Handed B-DNA - Langridge), abdna (Right Handed B-DNA - Arnott), sbdna (Left Handed B-DNA - Sasisekharan), adna (Right Handed A-DNA - Arnott). * **compiler** (*str*) - ("gcc") Alternative C compiler for nab. * **linker** (*str*) - ("gfortran") Alternative Fortran linker for nab. * **binary_path** (*str*) - ("nab") Path to the nab executable binary. * **remove_tmp** (*bool*) - (True) [WF property] Remove temporal files. * **restart** (*bool*) - (False) [WF property] Do not execute if output files exist. * **sandbox_path** (*str*) - ("./") [WF property] Parent path to the sandbox directory. * **container_path** (*str*) - (None) Container path definition. * **container_image** (*str*) - ('afandiadib/ambertools:serial') Container image definition. * **container_volume_path** (*str*) - ('/tmp') Container volume path definition. * **container_working_dir** (*str*) - (None) Container working directory definition. * **container_user_id** (*str*) - (None) Container user_id definition. * **container_shell_path** (*str*) - ('/bin/bash') Path to default shell inside the container. Examples: This is a use example of how to use the building block from Python:: from biobb_amber.nab.nab_build_dna_structure import nab_build_dna_structure prop = { 'sequence': 'GCGCGGCTGATAAACGAAAGC' } nab_build_dna_structure(output_pdb_path='/path/to/newStructure.pdb', properties=prop) Info: * wrapped_software: * name: AmberTools nab * version: >20.9 * license: LGPL 2.1 * ontology: * name: EDAM * schema: http://edamontology.org/EDAM.owl """ def __init__(self, output_pdb_path, properties, **kwargs): properties = properties or {} # Call parent class constructor super().__init__(properties) self.locals_var_dict = locals().copy() # Input/Output files self.io_dict = { 'in': {}, 'out': {'output_pdb_path': output_pdb_path} } # Properties specific for BB self.properties = properties self.sequence = properties.get('sequence', "GCGCGGCTGATAAACGAAAGC") self.helix_type = properties.get('helix_type', "lbdna") self.compiler = properties.get('compiler', "gcc") self.linker = properties.get('linker', "gfortran") self.binary_path = properties.get('binary_path', 'nab') # Check the properties self.check_properties(properties) self.check_arguments()
[docs] def check_data_params(self, out_log, err_log): """ Checks input/output paths correctness """ # Check output(s) self.io_dict["out"]["output_pdb_path"] = check_output_path(self.io_dict["out"]["output_pdb_path"], "output_pdb_path", False, out_log, self.__class__.__name__)
[docs] @launchlogger def launch(self): """Launches the execution of the NabBuildDNAStructure module.""" # check input/output paths and parameters self.check_data_params(self.out_log, self.err_log) # Setup Biobb if self.check_restart(): return 0 self.stage_files() # Creating temporary folder # self.tmp_folder = fu.create_unique_dir() # fu.log('Creating %s temporary folder' % self.tmp_folder, self.out_log) # create .nab file # molecule m; # m = fd_helix( "abdna", "aaaaaaaaaa", "dna" ); # putpdb( "nuc.pdb", m, "-wwpdb"); acid_type = 'dna' if ("rna" in self.helix_type): acid_type = 'rna' # Creating temporary folder & Leap configuration (instructions) file if self.container_path: instructions_file = str(PurePath(self.stage_io_dict['unique_dir']).joinpath("nuc.nab")) instructions_file_path = str(PurePath(self.container_volume_path).joinpath("nuc.nab")) self.tmp_folder = None else: self.tmp_folder = fu.create_unique_dir() instructions_file = str(PurePath(self.tmp_folder).joinpath("nuc.nab")) fu.log('Creating %s temporary folder' % self.tmp_folder, self.out_log) instructions_file_path = instructions_file # instructions_file = str(PurePath(self.tmp_folder).joinpath("nuc.nab")) with open(instructions_file, 'w') as nabin: nabin.write("molecule m; \n") nabin.write("m = fd_helix( \"" + self.helix_type + "\", \"" + self.sequence + "\", \"" + acid_type + "\" ); \n") nabin.write("putpdb( \"" + self.stage_io_dict['out']['output_pdb_path'] + "\" , m, \"-wwpdb\");\n") # Command line if self.container_path: nuc_path = self.container_volume_path self.cmd = [self.binary_path, '--compile', self.compiler, '-Xlinker', self.linker, instructions_file_path, ' ; ' + nuc_path + '/nuc' ] else: nuc_path = './' + self.tmp_folder self.cmd = [self.binary_path, '--compiler', self.compiler, '--linker', self.linker, instructions_file_path, ' ; ' + nuc_path + '/nuc' ] # Run Biobb block self.run_biobb() # Copy files to host self.copy_to_host() # remove temporary folder(s) self.tmp_files.extend([ self.stage_io_dict.get("unique_dir"), self.tmp_folder, "nab.log", "tleap.out" ]) self.remove_tmp_files() self.check_arguments(output_files_created=True, raise_exception=False) return self.return_code
[docs]def nab_build_dna_structure(output_pdb_path: str, properties: dict = None, **kwargs) -> int: """Create :class:`NabBuildDNAStructure <nab.nab_build_dna_structure.NabBuildDNAStructure>`nab.nab_build_dna_structure.NabBuildDNAStructure class and execute :meth:`launch() <nab.nab_build_dna_structure.NabBuildDNAStructure.launch>` method""" return NabBuildDNAStructure(output_pdb_path=output_pdb_path, properties=properties).launch()
[docs]def main(): parser = argparse.ArgumentParser(description='Building a 3D structure from a DNA sequence using nab.', formatter_class=lambda prog: argparse.RawTextHelpFormatter(prog, width=99999)) parser.add_argument('--config', required=False, help='Configuration file') # Specific args required_args = parser.add_argument_group('required arguments') required_args.add_argument('--output_pdb_path', required=True, help='Linear (unfolded) 3D structure PDB file. Accepted formats: pdb.') args = parser.parse_args() config = args.config if args.config else None properties = settings.ConfReader(config=config).get_prop_dic() # Specific call nab_build_dna_structure(output_pdb_path=args.output_pdb_path, properties=properties)
if __name__ == '__main__': main()