BioBB AMBER Command Line Help

Generic usage:

biobb_command [-h] --config CONFIG --input_file(s) <input_file(s)> --output_file <output_file>

Leap_solvate

Wrapper of the AmberTools (AMBER MD Package) leap tool module.

Get help

Command:

leap_solvate -h

usage: leap_solvate [-h] [--config CONFIG] --input_pdb_path INPUT_PDB_PATH [--input_lib_path INPUT_LIB_PATH] [--input_frcmod_path INPUT_FRCMOD_PATH] [--input_params_path INPUT_PARAMS_PATH] [--input_source_path INPUT_SOURCE_PATH] --output_pdb_path OUTPUT_PDB_PATH --output_top_path OUTPUT_TOP_PATH --output_crd_path OUTPUT_CRD_PATH

Generating and solvating a system box for an AMBER MD system. using tLeap program from AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_pdb_path INPUT_PDB_PATH
                        Input 3D structure PDB file. Accepted formats: pdb.
  --input_lib_path INPUT_LIB_PATH
                        Input ligand library parameters file. Accepted formats: lib, zip.
  --input_frcmod_path INPUT_FRCMOD_PATH
                        Input ligand frcmod parameters file. Accepted formats: frcmod, zip.
  --input_params_path INPUT_PARAMS_PATH
                        Additional leap parameter files to load with loadAmberParams Leap command. Accepted formats: leapin, in, txt, zip.
  --input_source_path INPUT_SOURCE_PATH
                        Additional leap command files to load with source Leap command. Accepted formats: leapin, in, txt, zip.
  --output_pdb_path OUTPUT_PDB_PATH
                        Output 3D structure PDB file matching the topology file. Accepted formats: pdb.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top.
  --output_crd_path OUTPUT_CRD_PATH
                        Output coordinates file (AMBER crd). Accepted formats: crd.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_pdb_path (string): Input 3D structure PDB file. File type: input. Sample file. Accepted formats: PDB
input_lib_path (string): Input ligand library parameters file. File type: input. Sample file. Accepted formats: LIB, ZIP
input_frcmod_path (string): Input ligand frcmod parameters file. File type: input. Sample file. Accepted formats: FRCMOD, ZIP
input_params_path (string): Additional leap parameter files to load with loadAmberParams Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP
input_source_path (string): Additional leap command files to load with source Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP
output_pdb_path (string): Output 3D structure PDB file matching the topology file. File type: output. Sample file. Accepted formats: PDB
output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP
output_crd_path (string): Output coordinates file (AMBER crd). File type: output. Sample file. Accepted formats: CRD, MDCRD, INPCRD

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

forcefield (array): ([protein.ff14SB,DNA.bsc1,gaff]) Forcefield to be used for the structure generation. .
water_type (string): (TIP3PBOX) Water molecule parameters to be used for the topology. .
box_type (string): (truncated_octahedron) Type for the MD system box. .
ions_type (string): (ionsjc_tip3p) Ions type. .
neutralise (boolean): (False) Energetically neutralise the system adding the necessary counterions..
iso (boolean): (False) Make the box isometric..
positive_ions_number (integer): (0) Number of additional positive ions to include in the system box..
negative_ions_number (integer): (0) Number of additional negative ions to include in the system box..
positive_ions_type (string): (Na+) Type of additional positive ions to include in the system box. .
negative_ions_type (string): (Cl-) Type of additional negative ions to include in the system box. .
distance_to_molecule (number): (8.0) Size for the MD system box -in Angstroms-, defined such as the minimum distance between any atom originally present in solute and the edge of the periodic box is given by this distance parameter..
closeness (number): (1.0) How close, in Å, solvent ATOMs may come to solute ATOMs..
binary_path (string): (tleap) Path to the tleap executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  box_type: truncated_octahedron
  distance_to_molecule: '9.0'
  forcefield:
  - protein.ff14SB
  remove_tmp: true
  water_type: TIP3PBOX

Docker config file 

properties:
  box_type: truncated_octahedron
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp
  distance_to_molecule: '9.0'
  forcefield:
  - protein.ff14SB
  water_type: TIP3PBOX

Command line

leap_solvate --config config_leap_solvate.yml --input_pdb_path structure.leap.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.solv.pdb --output_top_path structure.solv.top --output_crd_path structure.solv.crd

JSON

Common config file 

{
  "properties": {
    "forcefield": [
      "protein.ff14SB"
    ],
    "water_type": "TIP3PBOX",
    "distance_to_molecule": "9.0",
    "box_type": "truncated_octahedron",
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "forcefield": [
      "protein.ff14SB"
    ],
    "water_type": "TIP3PBOX",
    "distance_to_molecule": "9.0",
    "box_type": "truncated_octahedron",
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

leap_solvate --config config_leap_solvate.json --input_pdb_path structure.leap.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.solv.pdb --output_top_path structure.solv.top --output_crd_path structure.solv.crd

Sander_mdrun

Wrapper of the AmberTools (AMBER MD Package) sander tool module.

Get help

Command:

sander_mdrun -h

usage: sander_mdrun [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --input_crd_path INPUT_CRD_PATH [--input_mdin_path INPUT_MDIN_PATH] [--input_cpin_path INPUT_CPIN_PATH] [--input_ref_path INPUT_REF_PATH] --output_log_path OUTPUT_LOG_PATH --output_traj_path OUTPUT_TRAJ_PATH --output_rst_path OUTPUT_RST_PATH [--output_cpout_path OUTPUT_CPOUT_PATH] [--output_cprst_path OUTPUT_CPRST_PATH] [--output_mdinfo_path OUTPUT_MDINFO_PATH]

Running energy minimization, molecular dynamics, and NMR refinements using sander tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file
  --input_mdin_path INPUT_MDIN_PATH
                        Input configuration file (MD run options) (AMBER mdin). Accepted formats: mdin, in, txt.
  --input_cpin_path INPUT_CPIN_PATH
                        Input constant pH file (AMBER cpin). Accepted formats: cpin.
  --input_ref_path INPUT_REF_PATH
                        Input reference coordinates for position restraints. Accepted formats: rst, rst7.
  --output_cpout_path OUTPUT_CPOUT_PATH
                        Output constant pH file (AMBER cpout). Accepted formats: cpout.
  --output_cprst_path OUTPUT_CPRST_PATH
                        Output constant pH restart file (AMBER rstout). Accepted formats: cprst.
  --output_mdinfo_path OUTPUT_MDINFO_PATH
                        Output MD info. Accepted formats: mdinfo.

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input topology file (AMBER ParmTop). Accepted formats: top, prmtop, parmtop.
  --input_crd_path INPUT_CRD_PATH
                        Input coordinates file (AMBER crd). Accepted formats: crd, mdcrd.
  --output_log_path OUTPUT_LOG_PATH
                        Output log file. Accepted formats: log, out, txt.
  --output_traj_path OUTPUT_TRAJ_PATH
                        Output trajectory file. Accepted formats: trj, crd, mdcrd, x.
  --output_rst_path OUTPUT_RST_PATH
                        Output restart file. Accepted formats: rst, rst7.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_top_path (string): Input topology file (AMBER ParmTop). File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP
input_crd_path (string): Input coordinates file (AMBER crd). File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD, NETCDF, NC, NCRST
input_mdin_path (string): Input configuration file (MD run options) (AMBER mdin). File type: input. Sample file. Accepted formats: MDIN, IN, TXT
input_cpin_path (string): Input constant pH file (AMBER cpin). File type: input. Sample file. Accepted formats: CPIN
input_ref_path (string): Input reference coordinates for position restraints. File type: input. Sample file. Accepted formats: RST, RST7, NETCDF, NC, NCRST, CRD
output_log_path (string): Output log file. File type: output. Sample file. Accepted formats: LOG, OUT, TXT, O
output_traj_path (string): Output trajectory file. File type: output. Sample file. Accepted formats: TRJ, CRD, MDCRD, X, NETCDF, NC
output_rst_path (string): Output restart file. File type: output. Sample file. Accepted formats: RST, RST7, NETCDF, NC, NCRST
output_cpout_path (string): Output constant pH file (AMBER cpout). File type: output. Sample file. Accepted formats: CPOUT
output_cprst_path (string): Output constant pH restart file (AMBER rstout). File type: output. Sample file. Accepted formats: CPRST, RST, RST7
output_mdinfo_path (string): Output MD info. File type: output. Sample file. Accepted formats: MDINFO

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

mdin (object): ({}) Sander MD run options specification. (Used if input_mdin_path is None).
simulation_type (string): (minimization) Default options for the mdin file. Each creates a different mdin file. .
binary_path (string): (sander) sander binary path to be used..
mpi_bin (string): (None) Path to the MPI runner. Usually “mpirun” or “srun”..
mpi_np (integer): (0) Number of MPI processes. Usually an integer bigger than 1..
mpi_flags (string): (None) Path to the MPI hostlist file..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  mdin:
    ioutfm: 0
    maxcyc: 500
    ntwx: 100
  remove_tmp: true
  simulation_type: minimization

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp
  mdin:
    ioutfm: 0
    maxcyc: 500
    ntwx: 100
  simulation_type: minimization

Command line

sander_mdrun --config config_sander_mdrun.yml --input_top_path cln025.prmtop --input_crd_path cln025.inpcrd --input_mdin_path npt.mdin --input_cpin_path cln025.cpin --input_ref_path sander.rst --output_log_path sander.log --output_traj_path sander.x --output_rst_path sander.rst --output_cpout_path sander.cpout --output_cprst_path sander.cprst --output_mdinfo_path sander.mdinfo

JSON

Common config file 

{
  "properties": {
    "simulation_type": "minimization",
    "mdin": {
      "maxcyc": 500,
      "ntwx": 100,
      "ioutfm": 0
    },
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "simulation_type": "minimization",
    "mdin": {
      "maxcyc": 500,
      "ntwx": 100,
      "ioutfm": 0
    },
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

sander_mdrun --config config_sander_mdrun.json --input_top_path cln025.prmtop --input_crd_path cln025.inpcrd --input_mdin_path npt.mdin --input_cpin_path cln025.cpin --input_ref_path sander.rst --output_log_path sander.log --output_traj_path sander.x --output_rst_path sander.rst --output_cpout_path sander.cpout --output_cprst_path sander.cprst --output_mdinfo_path sander.mdinfo

Cestats_run

Wrapper of the AmberTools (AMBER MD Package) cestats tool module.

Get help

Command:

cestats_run -h

usage: cestats_run [-h] [--config CONFIG] --input_cein_path INPUT_CEIN_PATH --input_ceout_path INPUT_CEOUT_PATH --output_dat_path OUTPUT_DAT_PATH [--output_population_path OUTPUT_POPULATION_PATH] [--output_chunk_path OUTPUT_CHUNK_PATH] [--output_cumulative_path OUTPUT_CUMULATIVE_PATH] [--output_conditional_path OUTPUT_CONDITIONAL_PATH] [--output_chunk_conditional_path OUTPUT_CHUNK_CONDITIONAL_PATH]

Analyzing the results of constant Redox potential MD simulations using cestats tool from the AMBER MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_cein_path INPUT_CEIN_PATH
                        Input cein or cpein file (from pmemd or sander) with titrating residue information. Accepted formats: cein, cpein.
  --input_ceout_path INPUT_CEOUT_PATH
                        Output ceout file (AMBER ceout). Accepted formats: ceout.
  --output_dat_path OUTPUT_DAT_PATH
                        Output file to which the standard calceo-type statistics are written. Accepted formats: dat, out, txt, o.
  --output_population_path OUTPUT_POPULATION_PATH
                        Output file where protonation state populations are printed for every state of every residue. Accepted formats: dat, out, txt, o.
  --output_chunk_path OUTPUT_CHUNK_PATH
                        Output file where the time series data calculated over chunks of the simulation are printed. Accepted formats: dat, out, txt, o.
  --output_cumulative_path OUTPUT_CUMULATIVE_PATH
                        Output file where the cumulative time series data is printed. Accepted formats: dat, out, txt, o.
  --output_conditional_path OUTPUT_CONDITIONAL_PATH
                        Output file with requested conditional probabilities. Accepted formats: dat, out, txt, o.
  --output_chunk_conditional_path OUTPUT_CHUNK_CONDITIONAL_PATH
                        Output file with a time series of the conditional probabilities over a trajectory split up into chunks. Accepted formats: dat, out, txt, o.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_cein_path (string): Input cein or cpein file (from pmemd or sander) with titrating residue information. File type: input. Sample file. Accepted formats: CEIN, CPEIN
input_ceout_path (string): Output ceout file (AMBER ceout). File type: input. Sample file. Accepted formats: CEOUT, ZIP, GZIP, GZ
output_dat_path (string): Output file to which the standard calceo-type statistics are written. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_population_path (string): Output file where protonation state populations are printed for every state of every residue. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_chunk_path (string): Output file where the time series data calculated over chunks of the simulation are printed. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_cumulative_path (string): Output file where the cumulative time series data is printed. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_conditional_path (string): Output file with requested conditional probabilities. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_chunk_conditional_path (string): Output file with a time series of the conditional probabilities over a trajectory split up into chunks. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

timestep (number): (0.002) Simulation time step -in ps-, used to print data as a function of time..
verbose (boolean): (False) Controls how much information is printed to the calceo-style output file. Options are: False - Just print fraction protonated. True - Print everything calceo prints..
interval (integer): (1000) Interval between which to print out time series data like chunks, cumulative data, and running averages. It is also used as the window of the conditional probability time series..
reduced (boolean): (True) Print out reduction fraction instead of oxidation fraction in time series data..
eos (boolean): (False) Print predicted Eos -via Nernst equation- in place of fraction reduced or oxidized..
calceo (boolean): (True) Triggers the calceo-style output..
running_avg_window (integer): (100) Defines a window size -in MD steps- for a moving, running average time series..
chunk_window (integer): (100) Computes the time series data over a chunk of the simulation of this specified size -window- time steps..
cumulative (boolean): (False) Computes the cumulative average time series data over the course of the trajectory..
fix_remd (string): () This option will trigger cestats to reassemble the titration data into pH-specific ensembles. This is an exclusive mode of the program, no other analyses will be done..
conditional (string): () Evaluates conditional probabilities. CONDITIONAL should be a string of the format: :,:,… or :PROT,:DEPROT,… or :;,:PROT,… where is the residue number in the prmtop and is either the state number or -p-rotonated or -d-eprotonated, case-insensitive..
binary_path (string): (cestats) Path to the cestats executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  remove_tmp: true

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp

Command line

cestats_run --config config_cestats_run.yml --input_cein_path structure.cein --input_ceout_path sander.ceout.gz --output_dat_path cestats.dat --output_population_path cestats.dat --output_chunk_path cestats.dat --output_cumulative_path cestats.dat --output_conditional_path cestats.dat --output_chunk_conditional_path cestats.dat

JSON

Common config file 

{
  "properties": {
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

cestats_run --config config_cestats_run.json --input_cein_path structure.cein --input_ceout_path sander.ceout.gz --output_dat_path cestats.dat --output_population_path cestats.dat --output_chunk_path cestats.dat --output_cumulative_path cestats.dat --output_conditional_path cestats.dat --output_chunk_conditional_path cestats.dat

Pmemd_mdrun

Wrapper of the AmberTools (AMBER MD Package) pmemd tool module.

Get help

Command:

pmemd_mdrun -h

usage: pmemd_mdrun [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --input_crd_path INPUT_CRD_PATH [--input_mdin_path INPUT_MDIN_PATH] [--input_cpin_path INPUT_CPIN_PATH] [--input_ref_path INPUT_REF_PATH] --output_log_path OUTPUT_LOG_PATH --output_traj_path OUTPUT_TRAJ_PATH --output_rst_path OUTPUT_RST_PATH [--output_cpout_path OUTPUT_CPOUT_PATH] [--output_cprst_path OUTPUT_CPRST_PATH] [--output_mdinfo_path OUTPUT_MDINFO_PATH]

Running molecular dynamics using pmemd tool from the AMBER MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input topology file (AMBER ParmTop). Accepted formats: top, prmtop, parmtop.
  --input_crd_path INPUT_CRD_PATH
                        Input coordinates file (AMBER crd). Accepted formats: crd, mdcrd.
  --input_mdin_path INPUT_MDIN_PATH
                        Input configuration file (MD run options) (AMBER mdin). Accepted formats: mdin, in, txt.
  --input_cpin_path INPUT_CPIN_PATH
                        Input constant pH file (AMBER cpin). Accepted formats: cpin.
  --input_ref_path INPUT_REF_PATH
                        Input reference coordinates for position restraints. Accepted formats: rst, rst7.
  --output_log_path OUTPUT_LOG_PATH
                        Output log file. Accepted formats: log, out, txt.
  --output_traj_path OUTPUT_TRAJ_PATH
                        Output trajectory file. Accepted formats: trj, crd, mdcrd, x.
  --output_rst_path OUTPUT_RST_PATH
                        Output restart file. Accepted formats: rst, rst7.
  --output_cpout_path OUTPUT_CPOUT_PATH
                        Output constant pH file (AMBER cpout). Accepted formats: cpout.
  --output_cprst_path OUTPUT_CPRST_PATH
                        Output constant pH restart file (AMBER rstout). Accepted formats: cprst.
  --output_mdinfo_path OUTPUT_MDINFO_PATH
                        Output MD info. Accepted formats: mdinfo.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_top_path (string): Input topology file (AMBER ParmTop). File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP
input_crd_path (string): Input coordinates file (AMBER crd). File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD, RST, RST7, NETCDF, NC, NCRST
input_mdin_path (string): Input configuration file (MD run options) (AMBER mdin). File type: input. Sample file. Accepted formats: MDIN, IN, TXT
input_cpin_path (string): Input constant pH file (AMBER cpin). File type: input. Sample file. Accepted formats: CPIN
input_ref_path (string): Input reference coordinates for position restraints. File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD, RST, RST7, NETCDF, NC, NCRST
output_log_path (string): Output log file. File type: output. Sample file. Accepted formats: LOG, OUT, TXT, O
output_traj_path (string): Output trajectory file. File type: output. Sample file. Accepted formats: TRJ, CRD, MDCRD, X, NETCDF, NC
output_rst_path (string): Output restart file. File type: output. Sample file. Accepted formats: RST, RST7, NETCDF, NC, NCRST
output_cpout_path (string): Output constant pH file (AMBER cpout). File type: output. Sample file. Accepted formats: CPOUT
output_cprst_path (string): Output constant pH restart file (AMBER rstout). File type: output. Sample file. Accepted formats: CPRST, RST, RST7
output_mdinfo_path (string): Output MD info. File type: output. Sample file. Accepted formats: MDINFO

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

mdin (object): ({}) pmemd MD run options specification. (Used if input_mdin_path is None).
binary_path (string): (pmemd) pmemd binary path to be used..
simulation_type (string): (minimization) Default options for the mdin file. Each creates a different mdin file. .
mpi_bin (string): (None) Path to the MPI runner. Usually “mpirun” or “srun”..
mpi_np (integer): (0) Number of MPI processes. Usually an integer bigger than 1..
mpi_flags (string): (None) Path to the MPI hostlist file..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file 

properties:
  mdin:
    ioutfm: 0
    maxcyc: 500
    ntwx: 100
  remove_tmp: true
  simulation_type: minimization

Command line

pmemd_mdrun --config config_pmemd_mdrun.yml --input_top_path cln025.prmtop --input_crd_path cln025.inpcrd --input_mdin_path npt.mdin --input_cpin_path cln025.cpin --input_ref_path sander.rst --output_log_path sander.log --output_traj_path sander.x --output_rst_path sander.rst --output_cpout_path sander.cpout --output_cprst_path sander.cprst --output_mdinfo_path sander.mdinfo

JSON

Common config file 

{
  "properties": {
    "simulation_type": "minimization",
    "mdin": {
      "maxcyc": 500,
      "ntwx": 100,
      "ioutfm": 0
    },
    "remove_tmp": true
  }
}

Command line

pmemd_mdrun --config config_pmemd_mdrun.json --input_top_path cln025.prmtop --input_crd_path cln025.inpcrd --input_mdin_path npt.mdin --input_cpin_path cln025.cpin --input_ref_path sander.rst --output_log_path sander.log --output_traj_path sander.x --output_rst_path sander.rst --output_cpout_path sander.cpout --output_cprst_path sander.cprst --output_mdinfo_path sander.mdinfo

Pdb4amber_run

Wrapper of the AmberTools (AMBER MD Package) pdb4amber tool module.

Get help

Command:

pdb4amber_run -h

usage: pdb4amber_run [-h] [--config CONFIG] --input_pdb_path INPUT_PDB_PATH --output_pdb_path OUTPUT_PDB_PATH

Analyse PDB files and clean them for further usage, especially with the LEaP programs of Amber, using pdb4amber tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_pdb_path INPUT_PDB_PATH
                        Input 3D structure PDB file. Accepted formats: pdb.
  --output_pdb_path OUTPUT_PDB_PATH
                        Output 3D structure PDB file. Accepted formats: pdb.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_pdb_path (string): Input 3D structure PDB file. File type: input. Sample file. Accepted formats: PDB
output_pdb_path (string): Output 3D structure PDB file. File type: output. Sample file. Accepted formats: PDB

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

remove_hydrogens (boolean): (False) Remove hydrogen atoms from the PDB file..
remove_waters (boolean): (False) Remove water molecules from the PDB file..
constant_pH (boolean): (False) Rename ionizable residues e.g. GLU,ASP,HIS for constant pH simulation..
binary_path (string): (pdb4amber) Path to the pdb4amber executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  remove_tmp: true

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp

Command line

pdb4amber_run --config config_pdb4amber_run.yml --input_pdb_path 1aki_fixed.pdb --output_pdb_path structure.pdb4amber.pdb

JSON

Common config file 

{
  "properties": {
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

pdb4amber_run --config config_pdb4amber_run.json --input_pdb_path 1aki_fixed.pdb --output_pdb_path structure.pdb4amber.pdb

Process_mdout

Wrapper of the AmberTools (AMBER MD Package) process_mdout tool module.

Get help

Command:

process_mdout -h

usage: process_mdout [-h] [--config CONFIG] --input_log_path INPUT_LOG_PATH --output_dat_path OUTPUT_DAT_PATH

Parses the AMBER (sander) MD output file (log) and dumps statistics that can then be plotted. Using the process_mdout.pl tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_log_path INPUT_LOG_PATH
                        AMBER (sander) MD output (log) file. Accepted formats: log, out, txt, o.
  --output_dat_path OUTPUT_DAT_PATH
                        Dat output file containing data from the specified terms along the MD process. File type: output. Accepted formats: dat, txt, csv.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_log_path (string): AMBER (sander) MD output (log) file. File type: input. Sample file. Accepted formats: LOG, OUT, TXT, O
output_dat_path (string): Dat output file containing data from the specified terms along the minimization process. File type: output. Sample file. Accepted formats: DAT, TXT, CSV

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

terms (array): ([ETOT]) Statistics descriptors. .
binary_path (string): (process_mdout.perl) Path to the process_mdout.perl executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  remove_tmp: true
  terms:
  - TEMP
  - VOLUME
  - EKTOT

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp
  container_working_dir: /tmp
  terms:
  - TEMP
  - VOLUME
  - EKTOT

Command line

process_mdout --config config_process_mdout.yml --input_log_path sander.heat.log --output_dat_path sander.md.temp.dat

JSON

Common config file 

{
  "properties": {
    "terms": [
      "TEMP",
      "VOLUME",
      "EKTOT"
    ],
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "terms": [
      "TEMP",
      "VOLUME",
      "EKTOT"
    ],
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp",
    "container_working_dir": "/tmp"
  }
}

Command line

process_mdout --config config_process_mdout.json --input_log_path sander.heat.log --output_dat_path sander.md.temp.dat

Leap_add_ions

Wrapper of the AmberTools (AMBER MD Package) leap tool module.

Get help

Command:

leap_add_ions -h

usage: leap_add_ions [-h] [--config CONFIG] --input_pdb_path INPUT_PDB_PATH [--input_lib_path INPUT_LIB_PATH] [--input_frcmod_path INPUT_FRCMOD_PATH] [--input_params_path INPUT_PARAMS_PATH] [--input_source_path INPUT_SOURCE_PATH] --output_pdb_path OUTPUT_PDB_PATH --output_top_path OUTPUT_TOP_PATH --output_crd_path OUTPUT_CRD_PATH

Adds counterions to a system box for an AMBER MD system using tLeap.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_pdb_path INPUT_PDB_PATH
                        Input 3D structure PDB file. Accepted formats: pdb.
  --input_lib_path INPUT_LIB_PATH
                        Input ligand library parameters file. Accepted formats: lib, zip.
  --input_frcmod_path INPUT_FRCMOD_PATH
                        Input ligand frcmod parameters file. Accepted formats: frcmod, zip.
  --input_params_path INPUT_PARAMS_PATH
                        Additional leap parameter files to load with loadAmberParams Leap command. Accepted formats: leapin, in, txt, zip.
  --input_source_path INPUT_SOURCE_PATH
                        Additional leap command files to load with source Leap command. Accepted formats: leapin, in, txt, zip.
  --output_pdb_path OUTPUT_PDB_PATH
                        Output 3D structure PDB file matching the topology file. Accepted formats: pdb.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top.
  --output_crd_path OUTPUT_CRD_PATH
                        Output coordinates file (AMBER crd). Accepted formats: crd.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_pdb_path (string): Input 3D structure PDB file. File type: input. Sample file. Accepted formats: PDB
input_lib_path (string): Input ligand library parameters file. File type: input. Sample file. Accepted formats: LIB, ZIP
input_frcmod_path (string): Input ligand frcmod parameters file. File type: input. Sample file. Accepted formats: FRCMOD, ZIP
input_params_path (string): Additional leap parameter files to load with loadAmberParams Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP
input_source_path (string): Additional leap command files to load with source Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP
output_pdb_path (string): Output 3D structure PDB file matching the topology file. File type: output. Sample file. Accepted formats: PDB
output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP
output_crd_path (string): Output coordinates file (AMBER crd). File type: output. Sample file. Accepted formats: CRD, MDCRD, INPCRD

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

forcefield (array): ([protein.ff14SB,DNA.bsc1,gaff]) Forcefield to be used for the structure generation. .
water_type (string): (TIP3PBOX) Water molecule parameters to be used for the topology. .
box_type (string): (truncated_octahedron) Type for the MD system box. .
ions_type (string): (ionsjc_tip3p) Ions type. .
neutralise (boolean): (True) Energetically neutralise the system adding the necessary counterions..
ionic_concentration (number): (50.0) Additional ionic concentration to include in the system box. Units in Mol/L..
positive_ions_number (integer): (0) Number of additional positive ions to include in the system box..
negative_ions_number (integer): (0) Number of additional negative ions to include in the system box..
positive_ions_type (string): (Na+) Type of additional positive ions to include in the system box. .
negative_ions_type (string): (Cl-) Type of additional negative ions to include in the system box. .
binary_path (string): (tleap) Path to the tleap executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  box_type: truncated_octahedron
  forcefield:
  - DNA.bsc1
  ionic_concentration: 100
  ions_type: ionsjc_tip4pew
  positive_ions_type: K+
  water_type: OPCBOX

Docker config file 

properties:
  box_type: truncated_octahedron
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp
  forcefield:
  - DNA.bsc1
  ionic_concentration: 100
  ions_type: ionsjc_tip4pew
  positive_ions_type: K+
  water_type: OPCBOX

Command line

leap_add_ions --config config_leap_add_ions.yml --input_pdb_path structure.solv.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.ions.pdb --output_top_path structure.ions.top --output_crd_path structure.ions.crd

JSON

Common config file 

{
  "properties": {
    "forcefield": [
      "DNA.bsc1"
    ],
    "water_type": "OPCBOX",
    "ions_type": "ionsjc_tip4pew",
    "box_type": "truncated_octahedron",
    "ionic_concentration": 100,
    "positive_ions_type": "K+"
  }
}

Docker config file 

{
  "properties": {
    "forcefield": [
      "DNA.bsc1"
    ],
    "water_type": "OPCBOX",
    "ions_type": "ionsjc_tip4pew",
    "box_type": "truncated_octahedron",
    "ionic_concentration": 100,
    "positive_ions_type": "K+",
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

leap_add_ions --config config_leap_add_ions.json --input_pdb_path structure.solv.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.ions.pdb --output_top_path structure.ions.top --output_crd_path structure.ions.crd

Cphstats_run

Wrapper of the AmberTools (AMBER MD Package) cphstats tool module.

Get help

Command:

cphstats_run -h

usage: cphstats_run [-h] [--config CONFIG] --input_cpin_path INPUT_CPIN_PATH --input_cpout_path INPUT_CPOUT_PATH --output_dat_path OUTPUT_DAT_PATH [--output_population_path OUTPUT_POPULATION_PATH] [--output_chunk_path OUTPUT_CHUNK_PATH] [--output_cumulative_path OUTPUT_CUMULATIVE_PATH] [--output_conditional_path OUTPUT_CONDITIONAL_PATH] [--output_chunk_conditional_path OUTPUT_CHUNK_CONDITIONAL_PATH]

Analyzing the results of constant pH MD simulations using cphstats tool from the AMBER MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_cpin_path INPUT_CPIN_PATH
                        Input constant pH file (AMBER cpin). Accepted formats: cpin.
  --input_cpout_path INPUT_CPOUT_PATH
                        Output constant pH file (AMBER cpout). Accepted formats: cpout.
  --output_dat_path OUTPUT_DAT_PATH
                        Output file to which the standard calcpka-type statistics are written. Accepted formats: dat, out, txt, o.
  --output_population_path OUTPUT_POPULATION_PATH
                        Output file where protonation state populations are printed for every state of every residue. Accepted formats: dat, out, txt, o.
  --output_chunk_path OUTPUT_CHUNK_PATH
                        Output file where the time series data calculated over chunks of the simulation are printed. Accepted formats: dat, out, txt, o.
  --output_cumulative_path OUTPUT_CUMULATIVE_PATH
                        Output file where the cumulative time series data is printed. Accepted formats: dat, out, txt, o.
  --output_conditional_path OUTPUT_CONDITIONAL_PATH
                        Output file with requested conditional probabilities. Accepted formats: dat, out, txt, o.
  --output_chunk_conditional_path OUTPUT_CHUNK_CONDITIONAL_PATH
                        Output file with a time series of the conditional probabilities over a trajectory split up into chunks. Accepted formats: dat, out, txt, o.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_cpin_path (string): Input constant pH file (AMBER cpin). File type: input. Sample file. Accepted formats: CPIN
input_cpout_path (string): Output constant pH file (AMBER cpout). File type: input. Sample file. Accepted formats: CPOUT, ZIP, GZIP
output_dat_path (string): Output file to which the standard calcpka-type statistics are written. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_population_path (string): Output file where protonation state populations are printed for every state of every residue. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_chunk_path (string): Output file where the time series data calculated over chunks of the simulation are printed. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_cumulative_path (string): Output file where the cumulative time series data is printed. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_conditional_path (string): Output file with requested conditional probabilities. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O
output_chunk_conditional_path (string): Output file with a time series of the conditional probabilities over a trajectory split up into chunks. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

timestep (number): (0.002) Simulation time step -in ps-, used to print data as a function of time..
verbose (boolean): (False) Controls how much information is printed to the calcpka-style output file. Options are: False - Just print fraction protonated. True - Print everything calcpka prints..
interval (integer): (1000) Interval between which to print out time series data like chunks, cumulative data, and running averages. It is also used as the window of the conditional probability time series..
protonated (boolean): (True) Print out protonation fraction instead of deprotonation fraction in time series data..
pka (boolean): (False) Print predicted pKas -via Henderson-Hasselbalch equation- in place of fraction -de-protonated..
calcpka (boolean): (True) Triggers the calcpka-style output..
running_avg_window (integer): (100) Defines a window size -in MD steps- for a moving, running average time series..
chunk_window (integer): (100) Computes the time series data over a chunk of the simulation of this specified size -window- time steps..
cumulative (boolean): (False) Computes the cumulative average time series data over the course of the trajectory..
fix_remd (string): () This option will trigger cphstats to reassemble the titration data into pH-specific ensembles. This is an exclusive mode of the program, no other analyses will be done..
conditional (string): () Evaluates conditional probabilities. CONDITIONAL should be a string of the format: :,:,… or :PROT,:DEPROT,… or :;,:PROT,… where is the residue number in the prmtop and is either the state number or -p-rotonated or -d-eprotonated, case-insensitive..
binary_path (string): (cphstats) Path to the cphstats executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  remove_tmp: true

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp

Command line

cphstats_run --config config_cphstats_run.yml --input_cpin_path structure.cpin --input_cpout_path sander.pH.cpout --output_dat_path cphstats.pH.dat --output_population_path cphstats.pH.pop.dat --output_chunk_path cphstats.pH.dat --output_cumulative_path cphstats.pH.dat --output_conditional_path cphstats.pH.dat --output_chunk_conditional_path cphstats.pH.dat

JSON

Common config file 

{
  "properties": {
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

cphstats_run --config config_cphstats_run.json --input_cpin_path structure.cpin --input_cpout_path sander.pH.cpout --output_dat_path cphstats.pH.dat --output_population_path cphstats.pH.pop.dat --output_chunk_path cphstats.pH.dat --output_cumulative_path cphstats.pH.dat --output_conditional_path cphstats.pH.dat --output_chunk_conditional_path cphstats.pH.dat

Process_minout

Wrapper of the AmberTools (AMBER MD Package) process_minout tool module.

Get help

Command:

process_minout -h

usage: process_minout [-h] [--config CONFIG] --input_log_path INPUT_LOG_PATH --output_dat_path OUTPUT_DAT_PATH

Parses the AMBER (sander) minimization output file (log) and dumps statistics that can then be plotted. Using the process_minout.pl tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_log_path INPUT_LOG_PATH
                        AMBER (sander) minimization output (log) file. Accepted formats: log, out, txt, o.
  --output_dat_path OUTPUT_DAT_PATH
                        Dat output file containing data from the specified terms along the minimization process. File type: output. Accepted formats: dat, txt, csv.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_log_path (string): AMBER (sander) Minimization output (log) file. File type: input. Sample file. Accepted formats: LOG, OUT, TXT, O
output_dat_path (string): Dat output file containing data from the specified terms along the minimization process. File type: output. Sample file. Accepted formats: DAT, TXT, CSV

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

terms (array): ([ENERGY]) Statistics descriptors. .
binary_path (string): (process_minout.perl) Path to the process_minout.perl executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  remove_tmp: true

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp
  container_working_dir: /tmp

Command line

process_minout --config config_process_minout.yml --input_log_path sander.min.log --output_dat_path sander.min.energy.dat

JSON

Common config file 

{
  "properties": {
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp",
    "container_working_dir": "/tmp"
  }
}

Command line

process_minout --config config_process_minout.json --input_log_path sander.min.log --output_dat_path sander.min.energy.dat

Leap_build_linear_structure

Wrapper of the AmberTools (AMBER MD Package) leap tool module.

Get help

Command:

leap_build_linear_structure -h

usage: leap_build_linear_structure [-h] [--config CONFIG] --output_pdb_path OUTPUT_PDB_PATH

Building a linear (unfolded) 3D structure from an AA sequence.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --output_pdb_path OUTPUT_PDB_PATH
                        Linear (unfolded) 3D structure PDB file. Accepted formats: pdb.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

output_pdb_path (string): Linear (unfolded) 3D structure PDB file. File type: output. Sample file. Accepted formats: PDB

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

sequence (string): (ALA GLY SER PRO ARG ALA PRO GLY) Aminoacid sequence to convert to a linear 3D structure. Aminoacids should be written in 3-letter code, with a blank space between them..
forcefield (array): ([protein.ff14SB,DNA.bsc1,gaff]) Forcefield to be used for the structure generation. .
build_library (boolean): (False) Generate AMBER lib file for the structure..
binary_path (string): (tleap) Path to the tleap executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  build_library: false
  forcefield:
  - protein.ff14SB
  remove_tmp: true
  sequence: ALA PRO SER ARG LYS ASP GLU GLY GLY ALA

Docker config file 

properties:
  build_library: false
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp
  forcefield:
  - protein.ff14SB
  sequence: ALA PRO SER ARG LYS ASP GLU GLY GLY ALA

Command line

leap_build_linear_structure --config config_leap_build_linear_structure.yml --output_pdb_path structure.pdb

JSON

Common config file 

{
  "properties": {
    "sequence": "ALA PRO SER ARG LYS ASP GLU GLY GLY ALA",
    "build_library": false,
    "forcefield": [
      "protein.ff14SB"
    ],
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "sequence": "ALA PRO SER ARG LYS ASP GLU GLY GLY ALA",
    "build_library": false,
    "forcefield": [
      "protein.ff14SB"
    ],
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

leap_build_linear_structure --config config_leap_build_linear_structure.json --output_pdb_path structure.pdb

Nab_build_dna_structure

Wrapper of the AmberTools (AMBER MD Package) nab tool module.

Get help

Command:

nab_build_dna_structure -h

usage: nab_build_dna_structure [-h] [--config CONFIG] --output_pdb_path OUTPUT_PDB_PATH

Building a 3D structure from a DNA sequence using nab.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --output_pdb_path OUTPUT_PDB_PATH
                        Linear (unfolded) 3D structure PDB file. Accepted formats: pdb.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

output_pdb_path (string): DNA 3D structure PDB file. File type: output. Sample file. Accepted formats: PDB

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

sequence (string): (GCGCGGCTGATAAACGAAAGC) Nucleotide sequence to convert to a 3D structure. Nucleotides should be written in 1-letter code, with no spaces between them..
helix_type (string): (lbdna) DNA/RNA helix type. .
compiler (string): (gcc) Alternative C compiler for nab..
linker (string): (gfortran) Alternative Fortran linker for nab..
binary_path (string): (nab) Path to the nab executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  remove_tmp: true
  sequence: GCGCGGCTGATAAACGAAAGC

Command line

nab_build_dna_structure --config config_nab_build_dna_structure.yml --output_pdb_path ref_nab_build_dna_structure.pdb

JSON

Common config file 

{
  "properties": {
    "sequence": "GCGCGGCTGATAAACGAAAGC",
    "remove_tmp": true
  }
}

Command line

nab_build_dna_structure --config config_nab_build_dna_structure.json --output_pdb_path ref_nab_build_dna_structure.pdb

Parmed_hmassrepartition

Wrapper of the AmberTools (AMBER MD Package) parmed tool module.

Get help

Command:

parmed_hmassrepartition -h

usage: parmed_hmassrepartition [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH [--output_top_path OUTPUT_TOP_PATH]

Performs a Hydrogen Mass Repartition from an AMBER topology file using parmed tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input AMBER topology file. Accepted formats: top, parmtop, prmtop.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top, parmtop, prmtop.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_top_path (string): Input AMBER topology file. File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP
output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

binary_path (string): (parmed) Path to the parmed executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  remove_tmp: true

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp

Command line

parmed_hmassrepartition --config config_parmed_hmassrepartition.yml --input_top_path input.hmass.prmtop --output_top_path output.hmass.prmtop

JSON

Common config file 

{
  "properties": {
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

parmed_hmassrepartition --config config_parmed_hmassrepartition.json --input_top_path input.hmass.prmtop --output_top_path output.hmass.prmtop

Cpptraj_randomize_ions

Wrapper of the AmberTools (AMBER MD Package) cpptraj tool module.

Get help

Command:

cpptraj_randomize_ions -h

usage: cpptraj_randomize_ions [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --input_crd_path INPUT_CRD_PATH --output_pdb_path OUTPUT_PDB_PATH --output_crd_path OUTPUT_CRD_PATH

Swap specified ions with randomly selected solvent molecules using cpptraj tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input topology file (AMBER ParmTop). Accepted formats: top, parmtop, prmtop.
  --input_crd_path INPUT_CRD_PATH
                        Input coordinates file (AMBER crd). Accepted formats: crd, mdcrd, inpcrd.
  --output_pdb_path OUTPUT_PDB_PATH
                        Structure PDB file with randomized ions. Accepted formats: pdb.
  --output_crd_path OUTPUT_CRD_PATH
                        Structure CRD file with coordinates including randomized ions. Accepted formats: crd, mdcrd, inpcrd.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_top_path (string): Input topology file (AMBER ParmTop). File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP
input_crd_path (string): Input coordinates file (AMBER crd). File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD
output_pdb_path (string): Structure PDB file with randomized ions. File type: output. Sample file. Accepted formats: PDB
output_crd_path (string): Structure CRD file with coordinates including randomized ions. File type: output. Sample file. Accepted formats: CRD, MDCRD, INPCRD

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

ion_mask (string): (:K+,Cl-,Na+) Ions to be randomized. Cpptraj mask syntax can be found at the official Cpptraj manual..
solute_mask (string): (:DA,DC,DG,DT,D?3,D?5) Solute (or set of atoms) around which the ions can get no closer than the distance specified. Cpptraj mask syntax can be found at the official Cpptraj manual..
distance (number): (5.0) Minimum distance cutoff for the ions around the defined solute..
overlap (number): (3.5) Minimum distance between ions..
binary_path (string): (cpptraj) Path to the cpptraj executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  remove_tmp: true

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp

Command line

cpptraj_randomize_ions --config config_cpptraj_randomize_ions.yml --input_top_path structure.ions.parmtop --input_crd_path structure.ions.crd --output_pdb_path structure.randIons.pdb --output_crd_path structure.randIons.crd

JSON

Common config file 

{
  "properties": {
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

cpptraj_randomize_ions --config config_cpptraj_randomize_ions.json --input_top_path structure.ions.parmtop --input_crd_path structure.ions.crd --output_pdb_path structure.randIons.pdb --output_crd_path structure.randIons.crd

Amber_to_pdb

Wrapper of the AmberTools (AMBER MD Package) ambpdb tool module.

Get help

Command:

amber_to_pdb -h

usage: amber_to_pdb [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --input_crd_path INPUT_CRD_PATH --output_pdb_path OUTPUT_PDB_PATH

Generates a PDB structure from AMBER topology (parmtop) and coordinates (crd) files, using the ambpdb tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        AMBER topology file. Accepted formats: top, parmtop, prmtop.
  --input_crd_path INPUT_CRD_PATH
                        AMBER coordinates file. Accepted formats: crd, mdcrd, inpcrd.
  --output_pdb_path OUTPUT_PDB_PATH
                        Structure PDB file. Accepted formats: pdb.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_top_path (string): AMBER topology file. File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP
input_crd_path (string): AMBER coordinates file. File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD, RST
output_pdb_path (string): Structure PDB file. File type: output. Sample file. Accepted formats: PDB

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

binary_path (string): (ambpdb) Path to the ambpdb executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  remove_tmp: true

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp

Command line

amber_to_pdb --config config_amber_to_pdb.yml --input_top_path structure.leap.top --input_crd_path structure.leap.crd --output_pdb_path structure.ambpdb.pdb

JSON

Common config file 

{
  "properties": {
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

amber_to_pdb --config config_amber_to_pdb.json --input_top_path structure.leap.top --input_crd_path structure.leap.crd --output_pdb_path structure.ambpdb.pdb

Leap_gen_top

Wrapper of the AmberTools (AMBER MD Package) leap tool module.

Get help

Command:

leap_gen_top -h

usage: leap_gen_top [-h] [--config CONFIG] --input_pdb_path INPUT_PDB_PATH [--input_lib_path INPUT_LIB_PATH] [--input_frcmod_path INPUT_FRCMOD_PATH] [--input_params_path INPUT_PARAMS_PATH] [--input_source_path INPUT_SOURCE_PATH] --output_pdb_path OUTPUT_PDB_PATH --output_top_path OUTPUT_TOP_PATH --output_crd_path OUTPUT_CRD_PATH

Generating a MD topology from a molecule structure using tLeap program from AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_pdb_path INPUT_PDB_PATH
                        Input 3D structure PDB file. Accepted formats: pdb.
  --input_lib_path INPUT_LIB_PATH
                        Input ligand library parameters file. Accepted formats: lib, zip.
  --input_frcmod_path INPUT_FRCMOD_PATH
                        Input ligand frcmod parameters file. Accepted formats: frcmod, zip.
  --input_params_path INPUT_PARAMS_PATH
                        Additional leap parameter files to load with loadAmberParams Leap command. Accepted formats: leapin, in, txt, zip.
  --input_source_path INPUT_SOURCE_PATH
                        Additional leap command files to load with source Leap command. Accepted formats: leapin, in, txt, zip.
  --output_pdb_path OUTPUT_PDB_PATH
                        Output 3D structure PDB file matching the topology file. Accepted formats: pdb.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top.
  --output_crd_path OUTPUT_CRD_PATH
                        Output coordinates file (AMBER crd). Accepted formats: crd.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_pdb_path (string): Input 3D structure PDB file. File type: input. Sample file. Accepted formats: PDB
input_lib_path (string): Input ligand library parameters file. File type: input. Sample file. Accepted formats: LIB, ZIP
input_frcmod_path (string): Input ligand frcmod parameters file. File type: input. Sample file. Accepted formats: FRCMOD, ZIP
input_params_path (string): Additional leap parameter files to load with loadAmberParams Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP
input_source_path (string): Additional leap command files to load with source Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP
output_pdb_path (string): Output 3D structure PDB file matching the topology file. File type: output. Sample file. Accepted formats: PDB
output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP
output_crd_path (string): Output coordinates file (AMBER crd). File type: output. Sample file. Accepted formats: CRD, MDCRD, INPCRD

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

forcefield (array): ([protein.ff14SB,DNA.bsc1,gaff]) Forcefield to be used for the structure generation. .
binary_path (string): (tleap) Path to the tleap executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  forcefield:
  - protein.ff14SB
  remove_tmp: true

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp
  forcefield:
  - protein.ff14SB

Command line

leap_gen_top --config config_leap_gen_top.yml --input_pdb_path structure.leapin.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.leap.pdb --output_top_path structure.leap.top --output_crd_path structure.leap.crd

JSON

Common config file 

{
  "properties": {
    "forcefield": [
      "protein.ff14SB"
    ],
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "forcefield": [
      "protein.ff14SB"
    ],
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

leap_gen_top --config config_leap_gen_top.json --input_pdb_path structure.leapin.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.leap.pdb --output_top_path structure.leap.top --output_crd_path structure.leap.crd

Parmed_cpinutil

Wrapper of the AmberTools (AMBER MD Package) parmed tool module.

Get help

Command:

parmed_cpinutil -h

usage: parmed_cpinutil [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --output_cpin_path OUTPUT_CPIN_PATH [--output_top_path OUTPUT_TOP_PATH]

create a cpin file for constant pH simulations from an AMBER topology file using parmed program from AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input AMBER topology file. Accepted formats: top, parmtop, prmtop.
  --output_cpin_path OUTPUT_CPIN_PATH
                        Output AMBER constant pH input (CPin) file. Accepted formats: cpin.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top, parmtop, prmtop.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

input_top_path (string): Input AMBER topology file. File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP
output_cpin_path (string): Output AMBER constant pH input (CPin) file. File type: output. Sample file. Accepted formats: CPIN
output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

resnames (string): (None) Residue names to include in CPIN file. .
igb (integer): (2) Generalized Born model which you intend to use to evaluate dynamics or protonation state swaps. .
system (string): (Unknown) Name of system to titrate..
binary_path (string): (cpinutil.py) Path to the cpinutil.py executable binary..
remove_tmp (boolean): (True) Remove temporal files..
restart (boolean): (False) Do not execute if output files exist..
container_path (string): (None) Container path definition..
container_image (string): (afandiadib/ambertools:serial) Container image definition..
container_volume_path (string): (/tmp) Container volume path definition..
container_working_dir (string): (None) Container working directory definition..
container_user_id (string): (None) Container user_id definition..
container_shell_path (string): (/bin/bash) Path to default shell inside the container..

YAML

Common config file 

properties:
  igb: 2
  remove_tmp: true
  resnames: AS4 GL4
  system: cln025

Docker config file 

properties:
  container_image: afandiadib/ambertools:serial
  container_path: docker
  container_volume_path: /tmp
  igb: 2
  resnames: AS4 GL4
  system: cln025

Command line

parmed_cpinutil --config config_parmed_cpinutil.yml --input_top_path structure.solv.top --output_cpin_path cln025.cpin --output_top_path cln025.cpH.prmtop

JSON

Common config file 

{
  "properties": {
    "igb": 2,
    "resnames": "AS4 GL4",
    "system": "cln025",
    "remove_tmp": true
  }
}

Docker config file 

{
  "properties": {
    "igb": 2,
    "resnames": "AS4 GL4",
    "system": "cln025",
    "container_path": "docker",
    "container_image": "afandiadib/ambertools:serial",
    "container_volume_path": "/tmp"
  }
}

Command line

parmed_cpinutil --config config_parmed_cpinutil.json --input_top_path structure.solv.top --output_cpin_path cln025.cpin --output_top_path cln025.cpH.prmtop