BioBB AMBER Command Line Help

Generic usage:

biobb_command [-h] --config CONFIG --input_file(s) <input_file(s)> --output_file <output_file>

Nab_build_dna_structure

Wrapper of the AmberTools (AMBER MD Package) nab tool module.

Get help

Command:

nab_build_dna_structure -h
usage: nab_build_dna_structure [-h] [--config CONFIG] --output_pdb_path OUTPUT_PDB_PATH

Building a 3D structure from a DNA sequence using nab.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --output_pdb_path OUTPUT_PDB_PATH
                        Linear (unfolded) 3D structure PDB file. Accepted formats: pdb.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • output_pdb_path (string): DNA 3D structure PDB file. File type: output. Sample file. Accepted formats: PDB

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • sequence (string): (GCGCGGCTGATAAACGAAAGC) Nucleotide sequence to convert to a 3D structure. Nucleotides should be written in 1-letter code, with no spaces between them..

  • helix_type (string): (lbdna) DNA/RNA helix type. .

  • compiler (string): (gcc) Alternative C compiler for nab..

  • linker (string): (gfortran) Alternative Fortran linker for nab..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  remove_tmp: true
  sequence: GCGCGGCTGATAAACGAAAGC

Command line

nab_build_dna_structure --config config_nab_build_dna_structure.yml --output_pdb_path ref_nab_build_dna_structure.pdb

JSON

Common config file

{
  "properties": {
    "sequence": "GCGCGGCTGATAAACGAAAGC",
    "remove_tmp": true
  }
}

Command line

nab_build_dna_structure --config config_nab_build_dna_structure.json --output_pdb_path ref_nab_build_dna_structure.pdb

Cphstats_run

Wrapper of the AmberTools (AMBER MD Package) cphstats tool module.

Get help

Command:

cphstats_run -h
usage: cphstats_run [-h] [--config CONFIG] --input_cpin_path INPUT_CPIN_PATH --input_cpout_path INPUT_CPOUT_PATH --output_dat_path OUTPUT_DAT_PATH [--output_population_path OUTPUT_POPULATION_PATH] [--output_chunk_path OUTPUT_CHUNK_PATH] [--output_cumulative_path OUTPUT_CUMULATIVE_PATH] [--output_conditional_path OUTPUT_CONDITIONAL_PATH] [--output_chunk_conditional_path OUTPUT_CHUNK_CONDITIONAL_PATH]

Analyzing the results of constant pH MD simulations using cphstats tool from the AMBER MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_cpin_path INPUT_CPIN_PATH
                        Input constant pH file (AMBER cpin). Accepted formats: cpin.
  --input_cpout_path INPUT_CPOUT_PATH
                        Output constant pH file (AMBER cpout). Accepted formats: cpout.
  --output_dat_path OUTPUT_DAT_PATH
                        Output file to which the standard calcpka-type statistics are written. Accepted formats: dat, out, txt, o.
  --output_population_path OUTPUT_POPULATION_PATH
                        Output file where protonation state populations are printed for every state of every residue. Accepted formats: dat, out, txt, o.
  --output_chunk_path OUTPUT_CHUNK_PATH
                        Output file where the time series data calculated over chunks of the simulation are printed. Accepted formats: dat, out, txt, o.
  --output_cumulative_path OUTPUT_CUMULATIVE_PATH
                        Output file where the cumulative time series data is printed. Accepted formats: dat, out, txt, o.
  --output_conditional_path OUTPUT_CONDITIONAL_PATH
                        Output file with requested conditional probabilities. Accepted formats: dat, out, txt, o.
  --output_chunk_conditional_path OUTPUT_CHUNK_CONDITIONAL_PATH
                        Output file with a time series of the conditional probabilities over a trajectory split up into chunks. Accepted formats: dat, out, txt, o.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_cpin_path (string): Input constant pH file (AMBER cpin). File type: input. Sample file. Accepted formats: CPIN

  • input_cpout_path (string): Output constant pH file (AMBER cpout). File type: input. Sample file. Accepted formats: CPOUT, ZIP, GZIP

  • output_dat_path (string): Output file to which the standard calcpka-type statistics are written. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_population_path (string): Output file where protonation state populations are printed for every state of every residue. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_chunk_path (string): Output file where the time series data calculated over chunks of the simulation are printed. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_cumulative_path (string): Output file where the cumulative time series data is printed. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_conditional_path (string): Output file with requested conditional probabilities. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_chunk_conditional_path (string): Output file with a time series of the conditional probabilities over a trajectory split up into chunks. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • timestep (number): (0.002) Simulation time step -in ps-, used to print data as a function of time..

  • verbose (boolean): (False) Controls how much information is printed to the calcpka-style output file. Options are: False - Just print fraction protonated. True - Print everything calcpka prints..

  • interval (integer): (1000) Interval between which to print out time series data like chunks, cumulative data, and running averages. It is also used as the window of the conditional probability time series..

  • protonated (boolean): (True) Print out protonation fraction instead of deprotonation fraction in time series data..

  • pka (boolean): (False) Print predicted pKas -via Henderson-Hasselbalch equation- in place of fraction -de-protonated..

  • calcpka (boolean): (True) Triggers the calcpka-style output..

  • running_avg_window (integer): (100) Defines a window size -in MD steps- for a moving, running average time series..

  • chunk_window (integer): (100) Computes the time series data over a chunk of the simulation of this specified size -window- time steps..

  • cumulative (boolean): (False) Computes the cumulative average time series data over the course of the trajectory..

  • fix_remd (string): () This option will trigger cphstats to reassemble the titration data into pH-specific ensembles. This is an exclusive mode of the program, no other analyses will be done..

  • conditional (string): () Evaluates conditional probabilities. CONDITIONAL should be a string of the format: :,:,… or :PROT,:DEPROT,… or :;,:PROT,… where is the residue number in the prmtop and is either the state number or -p-rotonated or -d-eprotonated, case-insensitive..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  remove_tmp: true

Command line

cphstats_run --config config_cphstats_run.yml --input_cpin_path structure.cpin --input_cpout_path sander.pH.cpout --output_dat_path cphstats.pH.dat --output_population_path cphstats.pH.pop.dat --output_chunk_path cphstats.pH.dat --output_cumulative_path cphstats.pH.dat --output_conditional_path cphstats.pH.dat --output_chunk_conditional_path cphstats.pH.dat

JSON

Common config file

{
  "properties": {
    "remove_tmp": true
  }
}

Command line

cphstats_run --config config_cphstats_run.json --input_cpin_path structure.cpin --input_cpout_path sander.pH.cpout --output_dat_path cphstats.pH.dat --output_population_path cphstats.pH.pop.dat --output_chunk_path cphstats.pH.dat --output_cumulative_path cphstats.pH.dat --output_conditional_path cphstats.pH.dat --output_chunk_conditional_path cphstats.pH.dat

Pdb4amber_run

Wrapper of the AmberTools (AMBER MD Package) pdb4amber tool module.

Get help

Command:

pdb4amber_run -h
usage: pdb4amber_run [-h] [--config CONFIG] --input_pdb_path INPUT_PDB_PATH --output_pdb_path OUTPUT_PDB_PATH

Analyse PDB files and clean them for further usage, especially with the LEaP programs of Amber, using pdb4amber tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_pdb_path INPUT_PDB_PATH
                        Input 3D structure PDB file. Accepted formats: pdb.
  --output_pdb_path OUTPUT_PDB_PATH
                        Output 3D structure PDB file. Accepted formats: pdb.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_pdb_path (string): Input 3D structure PDB file. File type: input. Sample file. Accepted formats: PDB

  • output_pdb_path (string): Output 3D structure PDB file. File type: output. Sample file. Accepted formats: PDB

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • remove_hydrogens (boolean): (False) Remove hydrogen atoms from the PDB file..

  • remove_waters (boolean): (False) Remove water molecules from the PDB file..

  • constant_pH (boolean): (False) Rename ionizable residues e.g. GLU,ASP,HIS for constant pH simulation..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  remove_tmp: true

Command line

pdb4amber_run --config config_pdb4amber_run.yml --input_pdb_path 1aki_fixed.pdb --output_pdb_path structure.pdb4amber.pdb

JSON

Common config file

{
  "properties": {
    "remove_tmp": true
  }
}

Command line

pdb4amber_run --config config_pdb4amber_run.json --input_pdb_path 1aki_fixed.pdb --output_pdb_path structure.pdb4amber.pdb

Parmed_hmassrepartition

Wrapper of the AmberTools (AMBER MD Package) parmed tool module.

Get help

Command:

parmed_hmassrepartition -h
usage: parmed_hmassrepartition [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH [--output_top_path OUTPUT_TOP_PATH]

Performs a Hydrogen Mass Repartition from an AMBER topology file using parmed tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input AMBER topology file. Accepted formats: top, parmtop, prmtop.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top, parmtop, prmtop.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_top_path (string): Input AMBER topology file. File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

  • output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  remove_tmp: true

Command line

parmed_hmassrepartition --config config_parmed_hmassrepartition.yml --input_top_path input.hmass.prmtop --output_top_path output.hmass.prmtop

JSON

Common config file

{
  "properties": {
    "remove_tmp": true
  }
}

Command line

parmed_hmassrepartition --config config_parmed_hmassrepartition.json --input_top_path input.hmass.prmtop --output_top_path output.hmass.prmtop

Sander_mdrun

Wrapper of the AmberTools (AMBER MD Package) sander tool module.

Get help

Command:

sander_mdrun -h
usage: sander_mdrun [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --input_crd_path INPUT_CRD_PATH [--input_mdin_path INPUT_MDIN_PATH] [--input_cpin_path INPUT_CPIN_PATH] [--input_ref_path INPUT_REF_PATH] --output_log_path OUTPUT_LOG_PATH --output_traj_path OUTPUT_TRAJ_PATH --output_rst_path OUTPUT_RST_PATH [--output_cpout_path OUTPUT_CPOUT_PATH] [--output_cprst_path OUTPUT_CPRST_PATH] [--output_mdinfo_path OUTPUT_MDINFO_PATH]

Running energy minimization, molecular dynamics, and NMR refinements using sander tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file
  --input_mdin_path INPUT_MDIN_PATH
                        Input configuration file (MD run options) (AMBER mdin). Accepted formats: mdin, in, txt.
  --input_cpin_path INPUT_CPIN_PATH
                        Input constant pH file (AMBER cpin). Accepted formats: cpin.
  --input_ref_path INPUT_REF_PATH
                        Input reference coordinates for position restraints. Accepted formats: rst, rst7.
  --output_cpout_path OUTPUT_CPOUT_PATH
                        Output constant pH file (AMBER cpout). Accepted formats: cpout.
  --output_cprst_path OUTPUT_CPRST_PATH
                        Output constant pH restart file (AMBER rstout). Accepted formats: cprst.
  --output_mdinfo_path OUTPUT_MDINFO_PATH
                        Output MD info. Accepted formats: mdinfo.

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input topology file (AMBER ParmTop). Accepted formats: top, prmtop, parmtop.
  --input_crd_path INPUT_CRD_PATH
                        Input coordinates file (AMBER crd). Accepted formats: crd, mdcrd.
  --output_log_path OUTPUT_LOG_PATH
                        Output log file. Accepted formats: log, out, txt.
  --output_traj_path OUTPUT_TRAJ_PATH
                        Output trajectory file. Accepted formats: trj, crd, mdcrd, x.
  --output_rst_path OUTPUT_RST_PATH
                        Output restart file. Accepted formats: rst, rst7.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_top_path (string): Input topology file (AMBER ParmTop). File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

  • input_crd_path (string): Input coordinates file (AMBER crd). File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD, NETCDF, NC, NCRST

  • input_mdin_path (string): Input configuration file (MD run options) (AMBER mdin). File type: input. Sample file. Accepted formats: MDIN, IN, TXT

  • input_cpin_path (string): Input constant pH file (AMBER cpin). File type: input. Sample file. Accepted formats: CPIN

  • input_ref_path (string): Input reference coordinates for position restraints. File type: input. Sample file. Accepted formats: RST, RST7, NETCDF, NC, NCRST, CRD

  • output_log_path (string): Output log file. File type: output. Sample file. Accepted formats: LOG, OUT, TXT, O

  • output_traj_path (string): Output trajectory file. File type: output. Sample file. Accepted formats: TRJ, CRD, MDCRD, X, NETCDF, NC

  • output_rst_path (string): Output restart file. File type: output. Sample file. Accepted formats: RST, RST7, NETCDF, NC, NCRST

  • output_cpout_path (string): Output constant pH file (AMBER cpout). File type: output. Sample file. Accepted formats: CPOUT

  • output_cprst_path (string): Output constant pH restart file (AMBER rstout). File type: output. Sample file. Accepted formats: CPRST, RST, RST7

  • output_mdinfo_path (string): Output MD info. File type: output. Sample file. Accepted formats: MDINFO

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • mdin (object): ({}) Sander MD run options specification. (Used if input_mdin_path is None).

  • simulation_type (string): (minimization) Default options for the mdin file. Each creates a different mdin file. .

  • sander_path (string): (sander) sander binary path to be used..

  • mpi_bin (string): (None) Path to the MPI runner. Usually “mpirun” or “srun”..

  • mpi_np (integer): (0) Number of MPI processes. Usually an integer bigger than 1..

  • mpi_flags (string): (None) Path to the MPI hostlist file..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  mdin:
    ioutfm: 0
    maxcyc: 500
    ntwx: 100
  remove_tmp: true
  simulation_type: minimization

Command line

sander_mdrun --config config_sander_mdrun.yml --input_top_path cln025.prmtop --input_crd_path cln025.inpcrd --input_mdin_path npt.mdin --input_cpin_path cln025.cpin --input_ref_path sander.rst --output_log_path sander.log --output_traj_path sander.x --output_rst_path sander.rst --output_cpout_path sander.cpout --output_cprst_path sander.cprst --output_mdinfo_path sander.mdinfo

JSON

Common config file

{
  "properties": {
    "simulation_type": "minimization",
    "mdin": {
      "maxcyc": 500,
      "ntwx": 100,
      "ioutfm": 0
    },
    "remove_tmp": true
  }
}

Command line

sander_mdrun --config config_sander_mdrun.json --input_top_path cln025.prmtop --input_crd_path cln025.inpcrd --input_mdin_path npt.mdin --input_cpin_path cln025.cpin --input_ref_path sander.rst --output_log_path sander.log --output_traj_path sander.x --output_rst_path sander.rst --output_cpout_path sander.cpout --output_cprst_path sander.cprst --output_mdinfo_path sander.mdinfo

Leap_gen_top

Wrapper of the AmberTools (AMBER MD Package) leap tool module.

Get help

Command:

leap_gen_top -h
usage: leap_gen_top [-h] [--config CONFIG] --input_pdb_path INPUT_PDB_PATH [--input_lib_path INPUT_LIB_PATH] [--input_frcmod_path INPUT_FRCMOD_PATH] [--input_params_path INPUT_PARAMS_PATH] [--input_source_path INPUT_SOURCE_PATH] --output_pdb_path OUTPUT_PDB_PATH --output_top_path OUTPUT_TOP_PATH --output_crd_path OUTPUT_CRD_PATH

Generating a MD topology from a molecule structure using tLeap program from AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_pdb_path INPUT_PDB_PATH
                        Input 3D structure PDB file. Accepted formats: pdb.
  --input_lib_path INPUT_LIB_PATH
                        Input ligand library parameters file. Accepted formats: lib, zip.
  --input_frcmod_path INPUT_FRCMOD_PATH
                        Input ligand frcmod parameters file. Accepted formats: frcmod, zip.
  --input_params_path INPUT_PARAMS_PATH
                        Additional leap parameter files to load with loadAmberParams Leap command. Accepted formats: leapin, in, txt, zip.
  --input_source_path INPUT_SOURCE_PATH
                        Additional leap command files to load with source Leap command. Accepted formats: leapin, in, txt, zip.
  --output_pdb_path OUTPUT_PDB_PATH
                        Output 3D structure PDB file matching the topology file. Accepted formats: pdb.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top.
  --output_crd_path OUTPUT_CRD_PATH
                        Output coordinates file (AMBER crd). Accepted formats: crd.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_pdb_path (string): Input 3D structure PDB file. File type: input. Sample file. Accepted formats: PDB

  • input_lib_path (string): Input ligand library parameters file. File type: input. Sample file. Accepted formats: LIB, ZIP

  • input_frcmod_path (string): Input ligand frcmod parameters file. File type: input. Sample file. Accepted formats: FRCMOD, ZIP

  • input_params_path (string): Additional leap parameter files to load with loadAmberParams Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP

  • input_source_path (string): Additional leap command files to load with source Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP

  • output_pdb_path (string): Output 3D structure PDB file matching the topology file. File type: output. Sample file. Accepted formats: PDB

  • output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

  • output_crd_path (string): Output coordinates file (AMBER crd). File type: output. Sample file. Accepted formats: CRD, MDCRD, INPCRD

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • forcefield (array): ([protein.ff14SB,DNA.bsc1,gaff]) Forcefield to be used for the structure generation. .

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  forcefield:
  - protein.ff14SB
  remove_tmp: true

Command line

leap_gen_top --config config_leap_gen_top.yml --input_pdb_path structure.leapin.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.leap.pdb --output_top_path structure.leap.top --output_crd_path structure.leap.crd

JSON

Common config file

{
  "properties": {
    "forcefield": [
      "protein.ff14SB"
    ],
    "remove_tmp": true
  }
}

Command line

leap_gen_top --config config_leap_gen_top.json --input_pdb_path structure.leapin.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.leap.pdb --output_top_path structure.leap.top --output_crd_path structure.leap.crd

Cestats_run

Wrapper of the AmberTools (AMBER MD Package) cestats tool module.

Get help

Command:

cestats_run -h
usage: cestats_run [-h] [--config CONFIG] --input_cein_path INPUT_CEIN_PATH --input_ceout_path INPUT_CEOUT_PATH --output_dat_path OUTPUT_DAT_PATH [--output_population_path OUTPUT_POPULATION_PATH] [--output_chunk_path OUTPUT_CHUNK_PATH] [--output_cumulative_path OUTPUT_CUMULATIVE_PATH] [--output_conditional_path OUTPUT_CONDITIONAL_PATH] [--output_chunk_conditional_path OUTPUT_CHUNK_CONDITIONAL_PATH]

Analyzing the results of constant Redox potential MD simulations using cestats tool from the AMBER MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_cein_path INPUT_CEIN_PATH
                        Input cein or cpein file (from pmemd or sander) with titrating residue information. Accepted formats: cein, cpein.
  --input_ceout_path INPUT_CEOUT_PATH
                        Output ceout file (AMBER ceout). Accepted formats: ceout.
  --output_dat_path OUTPUT_DAT_PATH
                        Output file to which the standard calceo-type statistics are written. Accepted formats: dat, out, txt, o.
  --output_population_path OUTPUT_POPULATION_PATH
                        Output file where protonation state populations are printed for every state of every residue. Accepted formats: dat, out, txt, o.
  --output_chunk_path OUTPUT_CHUNK_PATH
                        Output file where the time series data calculated over chunks of the simulation are printed. Accepted formats: dat, out, txt, o.
  --output_cumulative_path OUTPUT_CUMULATIVE_PATH
                        Output file where the cumulative time series data is printed. Accepted formats: dat, out, txt, o.
  --output_conditional_path OUTPUT_CONDITIONAL_PATH
                        Output file with requested conditional probabilities. Accepted formats: dat, out, txt, o.
  --output_chunk_conditional_path OUTPUT_CHUNK_CONDITIONAL_PATH
                        Output file with a time series of the conditional probabilities over a trajectory split up into chunks. Accepted formats: dat, out, txt, o.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_cein_path (string): Input cein or cpein file (from pmemd or sander) with titrating residue information. File type: input. Sample file. Accepted formats: CEIN, CPEIN

  • input_ceout_path (string): Output ceout file (AMBER ceout). File type: input. Sample file. Accepted formats: CEOUT, ZIP, GZIP, GZ

  • output_dat_path (string): Output file to which the standard calceo-type statistics are written. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_population_path (string): Output file where protonation state populations are printed for every state of every residue. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_chunk_path (string): Output file where the time series data calculated over chunks of the simulation are printed. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_cumulative_path (string): Output file where the cumulative time series data is printed. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_conditional_path (string): Output file with requested conditional probabilities. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

  • output_chunk_conditional_path (string): Output file with a time series of the conditional probabilities over a trajectory split up into chunks. File type: output. Sample file. Accepted formats: DAT, OUT, TXT, O

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • timestep (number): (0.002) Simulation time step -in ps-, used to print data as a function of time..

  • verbose (boolean): (False) Controls how much information is printed to the calceo-style output file. Options are: False - Just print fraction protonated. True - Print everything calceo prints..

  • interval (integer): (1000) Interval between which to print out time series data like chunks, cumulative data, and running averages. It is also used as the window of the conditional probability time series..

  • reduced (boolean): (True) Print out reduction fraction instead of oxidation fraction in time series data..

  • eos (boolean): (False) Print predicted Eos -via Nernst equation- in place of fraction reduced or oxidized..

  • calceo (boolean): (True) Triggers the calceo-style output..

  • running_avg_window (integer): (100) Defines a window size -in MD steps- for a moving, running average time series..

  • chunk_window (integer): (100) Computes the time series data over a chunk of the simulation of this specified size -window- time steps..

  • cumulative (boolean): (False) Computes the cumulative average time series data over the course of the trajectory..

  • fix_remd (string): () This option will trigger cestats to reassemble the titration data into pH-specific ensembles. This is an exclusive mode of the program, no other analyses will be done..

  • conditional (string): () Evaluates conditional probabilities. CONDITIONAL should be a string of the format: :,:,… or :PROT,:DEPROT,… or :;,:PROT,… where is the residue number in the prmtop and is either the state number or -p-rotonated or -d-eprotonated, case-insensitive..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  remove_tmp: true

Command line

cestats_run --config config_cestats_run.yml --input_cein_path structure.cein --input_ceout_path sander.ceout.gz --output_dat_path cestats.dat --output_population_path cestats.dat --output_chunk_path cestats.dat --output_cumulative_path cestats.dat --output_conditional_path cestats.dat --output_chunk_conditional_path cestats.dat

JSON

Common config file

{
  "properties": {
    "remove_tmp": true
  }
}

Command line

cestats_run --config config_cestats_run.json --input_cein_path structure.cein --input_ceout_path sander.ceout.gz --output_dat_path cestats.dat --output_population_path cestats.dat --output_chunk_path cestats.dat --output_cumulative_path cestats.dat --output_conditional_path cestats.dat --output_chunk_conditional_path cestats.dat

Process_minout

Wrapper of the AmberTools (AMBER MD Package) process_minout tool module.

Get help

Command:

process_minout -h
usage: process_minout [-h] [--config CONFIG] --input_log_path INPUT_LOG_PATH --output_dat_path OUTPUT_DAT_PATH

Parses the AMBER (sander) minimization output file (log) and dumps statistics that can then be plotted. Using the process_minout.pl tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_log_path INPUT_LOG_PATH
                        AMBER (sander) minimization output (log) file. Accepted formats: log, out, txt, o.
  --output_dat_path OUTPUT_DAT_PATH
                        Dat output file containing data from the specified terms along the minimization process. File type: output. Accepted formats: dat, txt, csv.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_log_path (string): AMBER (sander) Minimization output (log) file. File type: input. Sample file. Accepted formats: LOG, OUT, TXT, O

  • output_dat_path (string): Dat output file containing data from the specified terms along the minimization process. File type: output. Sample file. Accepted formats: DAT, TXT, CSV

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • terms (array): ([ENERGY]) Statistics descriptors. .

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  remove_tmp: true

Command line

process_minout --config config_process_minout.yml --input_log_path sander.min.log --output_dat_path sander.min.energy.dat

JSON

Common config file

{
  "properties": {
    "remove_tmp": true
  }
}

Command line

process_minout --config config_process_minout.json --input_log_path sander.min.log --output_dat_path sander.min.energy.dat

Process_mdout

Wrapper of the AmberTools (AMBER MD Package) process_mdout tool module.

Get help

Command:

process_mdout -h
usage: process_mdout [-h] [--config CONFIG] --input_log_path INPUT_LOG_PATH --output_dat_path OUTPUT_DAT_PATH

Parses the AMBER (sander) MD output file (log) and dumps statistics that can then be plotted. Using the process_mdout.pl tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_log_path INPUT_LOG_PATH
                        AMBER (sander) MD output (log) file. Accepted formats: log, out, txt, o.
  --output_dat_path OUTPUT_DAT_PATH
                        Dat output file containing data from the specified terms along the MD process. File type: output. Accepted formats: dat, txt, csv.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_log_path (string): AMBER (sander) MD output (log) file. File type: input. Sample file. Accepted formats: LOG, OUT, TXT, O

  • output_dat_path (string): Dat output file containing data from the specified terms along the minimization process. File type: output. Sample file. Accepted formats: DAT, TXT, CSV

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • terms (array): ([ETOT]) Statistics descriptors. .

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  remove_tmp: true
  terms:
  - TEMP

Command line

process_mdout --config config_process_mdout.yml --input_log_path sander.heat.log --output_dat_path sander.md.temp.dat

JSON

Common config file

{
  "properties": {
    "terms": [
      "TEMP"
    ],
    "remove_tmp": true
  }
}

Command line

process_mdout --config config_process_mdout.json --input_log_path sander.heat.log --output_dat_path sander.md.temp.dat

Pmemd_mdrun

Wrapper of the AmberTools (AMBER MD Package) pmemd tool module.

Get help

Command:

pmemd_mdrun -h
usage: pmemd_mdrun [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --input_crd_path INPUT_CRD_PATH [--input_mdin_path INPUT_MDIN_PATH] [--input_cpin_path INPUT_CPIN_PATH] [--input_ref_path INPUT_REF_PATH] --output_log_path OUTPUT_LOG_PATH --output_traj_path OUTPUT_TRAJ_PATH --output_rst_path OUTPUT_RST_PATH [--output_cpout_path OUTPUT_CPOUT_PATH] [--output_cprst_path OUTPUT_CPRST_PATH] [--output_mdinfo_path OUTPUT_MDINFO_PATH]

Running molecular dynamics using pmemd tool from the AMBER MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input topology file (AMBER ParmTop). Accepted formats: top, prmtop, parmtop.
  --input_crd_path INPUT_CRD_PATH
                        Input coordinates file (AMBER crd). Accepted formats: crd, mdcrd.
  --input_mdin_path INPUT_MDIN_PATH
                        Input configuration file (MD run options) (AMBER mdin). Accepted formats: mdin, in, txt.
  --input_cpin_path INPUT_CPIN_PATH
                        Input constant pH file (AMBER cpin). Accepted formats: cpin.
  --input_ref_path INPUT_REF_PATH
                        Input reference coordinates for position restraints. Accepted formats: rst, rst7.
  --output_log_path OUTPUT_LOG_PATH
                        Output log file. Accepted formats: log, out, txt.
  --output_traj_path OUTPUT_TRAJ_PATH
                        Output trajectory file. Accepted formats: trj, crd, mdcrd, x.
  --output_rst_path OUTPUT_RST_PATH
                        Output restart file. Accepted formats: rst, rst7.
  --output_cpout_path OUTPUT_CPOUT_PATH
                        Output constant pH file (AMBER cpout). Accepted formats: cpout.
  --output_cprst_path OUTPUT_CPRST_PATH
                        Output constant pH restart file (AMBER rstout). Accepted formats: cprst.
  --output_mdinfo_path OUTPUT_MDINFO_PATH
                        Output MD info. Accepted formats: mdinfo.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_top_path (string): Input topology file (AMBER ParmTop). File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

  • input_crd_path (string): Input coordinates file (AMBER crd). File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD, RST, RST7, NETCDF, NC, NCRST

  • input_mdin_path (string): Input configuration file (MD run options) (AMBER mdin). File type: input. Sample file. Accepted formats: MDIN, IN, TXT

  • input_cpin_path (string): Input constant pH file (AMBER cpin). File type: input. Sample file. Accepted formats: CPIN

  • input_ref_path (string): Input reference coordinates for position restraints. File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD, RST, RST7, NETCDF, NC, NCRST

  • output_log_path (string): Output log file. File type: output. Sample file. Accepted formats: LOG, OUT, TXT, O

  • output_traj_path (string): Output trajectory file. File type: output. Sample file. Accepted formats: TRJ, CRD, MDCRD, X, NETCDF, NC

  • output_rst_path (string): Output restart file. File type: output. Sample file. Accepted formats: RST, RST7, NETCDF, NC, NCRST

  • output_cpout_path (string): Output constant pH file (AMBER cpout). File type: output. Sample file. Accepted formats: CPOUT

  • output_cprst_path (string): Output constant pH restart file (AMBER rstout). File type: output. Sample file. Accepted formats: CPRST, RST, RST7

  • output_mdinfo_path (string): Output MD info. File type: output. Sample file. Accepted formats: MDINFO

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • mdin (object): ({}) pmemd MD run options specification. (Used if input_mdin_path is None).

  • pmemd_path (string): (pmemd) pmemd binary path to be used..

  • simulation_type (string): (minimization) Default options for the mdin file. Each creates a different mdin file. .

  • mpi_bin (string): (None) Path to the MPI runner. Usually “mpirun” or “srun”..

  • mpi_np (integer): (0) Number of MPI processes. Usually an integer bigger than 1..

  • mpi_flags (string): (None) Path to the MPI hostlist file..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  mdin:
    ioutfm: 0
    maxcyc: 500
    ntwx: 100
  remove_tmp: true
  simulation_type: minimization

Command line

pmemd_mdrun --config config_pmemd_mdrun.yml --input_top_path cln025.prmtop --input_crd_path cln025.inpcrd --input_mdin_path npt.mdin --input_cpin_path cln025.cpin --input_ref_path sander.rst --output_log_path sander.log --output_traj_path sander.x --output_rst_path sander.rst --output_cpout_path sander.cpout --output_cprst_path sander.cprst --output_mdinfo_path sander.mdinfo

JSON

Common config file

{
  "properties": {
    "simulation_type": "minimization",
    "mdin": {
      "maxcyc": 500,
      "ntwx": 100,
      "ioutfm": 0
    },
    "remove_tmp": true
  }
}

Command line

pmemd_mdrun --config config_pmemd_mdrun.json --input_top_path cln025.prmtop --input_crd_path cln025.inpcrd --input_mdin_path npt.mdin --input_cpin_path cln025.cpin --input_ref_path sander.rst --output_log_path sander.log --output_traj_path sander.x --output_rst_path sander.rst --output_cpout_path sander.cpout --output_cprst_path sander.cprst --output_mdinfo_path sander.mdinfo

Parmed_cpinutil

Wrapper of the AmberTools (AMBER MD Package) parmed tool module.

Get help

Command:

parmed_cpinutil -h
usage: parmed_cpinutil [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --output_cpin_path OUTPUT_CPIN_PATH [--output_top_path OUTPUT_TOP_PATH]

create a cpin file for constant pH simulations from an AMBER topology file using parmed program from AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input AMBER topology file. Accepted formats: top, parmtop, prmtop.
  --output_cpin_path OUTPUT_CPIN_PATH
                        Output AMBER constant pH input (CPin) file. Accepted formats: cpin.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top, parmtop, prmtop.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_top_path (string): Input AMBER topology file. File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

  • output_cpin_path (string): Output AMBER constant pH input (CPin) file. File type: output. Sample file. Accepted formats: CPIN

  • output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • resnames (string): (None) Residue names to include in CPIN file. .

  • igb (integer): (2) Generalized Born model which you intend to use to evaluate dynamics or protonation state swaps. .

  • system (string): (Unknown) Name of system to titrate..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  igb: 2
  remove_tmp: true
  resnames: AS4 GL4
  system: cln025

Command line

parmed_cpinutil --config config_parmed_cpinutil.yml --input_top_path structure.solv.top --output_cpin_path cln025.cpin --output_top_path cln025.cpH.prmtop

JSON

Common config file

{
  "properties": {
    "igb": 2,
    "resnames": "AS4 GL4",
    "system": "cln025",
    "remove_tmp": true
  }
}

Command line

parmed_cpinutil --config config_parmed_cpinutil.json --input_top_path structure.solv.top --output_cpin_path cln025.cpin --output_top_path cln025.cpH.prmtop

Leap_add_ions

Wrapper of the AmberTools (AMBER MD Package) leap tool module.

Get help

Command:

leap_add_ions -h
usage: leap_add_ions [-h] [--config CONFIG] --input_pdb_path INPUT_PDB_PATH [--input_lib_path INPUT_LIB_PATH] [--input_frcmod_path INPUT_FRCMOD_PATH] [--input_params_path INPUT_PARAMS_PATH] [--input_source_path INPUT_SOURCE_PATH] --output_pdb_path OUTPUT_PDB_PATH --output_top_path OUTPUT_TOP_PATH --output_crd_path OUTPUT_CRD_PATH

Adds counterions to a system box for an AMBER MD system using tLeap.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_pdb_path INPUT_PDB_PATH
                        Input 3D structure PDB file. Accepted formats: pdb.
  --input_lib_path INPUT_LIB_PATH
                        Input ligand library parameters file. Accepted formats: lib, zip.
  --input_frcmod_path INPUT_FRCMOD_PATH
                        Input ligand frcmod parameters file. Accepted formats: frcmod, zip.
  --input_params_path INPUT_PARAMS_PATH
                        Additional leap parameter files to load with loadAmberParams Leap command. Accepted formats: leapin, in, txt, zip.
  --input_source_path INPUT_SOURCE_PATH
                        Additional leap command files to load with source Leap command. Accepted formats: leapin, in, txt, zip.
  --output_pdb_path OUTPUT_PDB_PATH
                        Output 3D structure PDB file matching the topology file. Accepted formats: pdb.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top.
  --output_crd_path OUTPUT_CRD_PATH
                        Output coordinates file (AMBER crd). Accepted formats: crd.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_pdb_path (string): Input 3D structure PDB file. File type: input. Sample file. Accepted formats: PDB

  • input_lib_path (string): Input ligand library parameters file. File type: input. Sample file. Accepted formats: LIB, ZIP

  • input_frcmod_path (string): Input ligand frcmod parameters file. File type: input. Sample file. Accepted formats: FRCMOD, ZIP

  • input_params_path (string): Additional leap parameter files to load with loadAmberParams Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP

  • input_source_path (string): Additional leap command files to load with source Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP

  • output_pdb_path (string): Output 3D structure PDB file matching the topology file. File type: output. Sample file. Accepted formats: PDB

  • output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

  • output_crd_path (string): Output coordinates file (AMBER crd). File type: output. Sample file. Accepted formats: CRD, MDCRD, INPCRD

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • forcefield (array): ([protein.ff14SB,DNA.bsc1,gaff]) Forcefield to be used for the structure generation. .

  • water_type (string): (TIP3PBOX) Water molecule parameters to be used for the topology. .

  • box_type (string): (truncated_octahedron) Type for the MD system box. .

  • ions_type (string): (ionsjc_tip3p) Ions type. .

  • neutralise (boolean): (True) Energetically neutralise the system adding the necessary counterions..

  • ionic_concentration (number): (50.0) Additional ionic concentration to include in the system box. Units in Mol/L..

  • positive_ions_number (integer): (0) Number of additional positive ions to include in the system box..

  • negative_ions_number (integer): (0) Number of additional negative ions to include in the system box..

  • positive_ions_type (string): (Na+) Type of additional positive ions to include in the system box. .

  • negative_ions_type (string): (Cl-) Type of additional negative ions to include in the system box. .

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  box_type: truncated_octahedron
  forcefield:
  - protein.ff14SB
  - DNA.bsc1
  ionic_concentration: 150
  negative_ions_type: Cl-
  neutralise: true
  positive_ions_type: K+
  remove_tmp: true
  water_type: TIP3PBOX

Command line

leap_add_ions --config config_leap_add_ions.yml --input_pdb_path structure.solv.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.ions.pdb --output_top_path structure.ions.top --output_crd_path structure.ions.crd

JSON

Common config file

{
  "properties": {
    "forcefield": [
      "protein.ff14SB",
      "DNA.bsc1"
    ],
    "water_type": "TIP3PBOX",
    "box_type": "truncated_octahedron",
    "neutralise": true,
    "positive_ions_type": "K+",
    "negative_ions_type": "Cl-",
    "ionic_concentration": 150,
    "remove_tmp": true
  }
}

Command line

leap_add_ions --config config_leap_add_ions.json --input_pdb_path structure.solv.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.ions.pdb --output_top_path structure.ions.top --output_crd_path structure.ions.crd

Leap_build_linear_structure

Wrapper of the AmberTools (AMBER MD Package) leap tool module.

Get help

Command:

leap_build_linear_structure -h
usage: leap_build_linear_structure [-h] [--config CONFIG] --output_pdb_path OUTPUT_PDB_PATH

Building a linear (unfolded) 3D structure from an AA sequence.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --output_pdb_path OUTPUT_PDB_PATH
                        Linear (unfolded) 3D structure PDB file. Accepted formats: pdb.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • output_pdb_path (string): Linear (unfolded) 3D structure PDB file. File type: output. Sample file. Accepted formats: PDB

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • sequence (string): (ALA GLY SER PRO ARG ALA PRO GLY) Aminoacid sequence to convert to a linear 3D structure. Aminoacids should be written in 3-letter code, with a blank space between them..

  • forcefield (array): ([protein.ff14SB,DNA.bsc1,gaff]) Forcefield to be used for the structure generation. .

  • build_library (boolean): (False) Generate AMBER lib file for the structure..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  build_library: false
  forcefield:
  - protein.ff14SB
  remove_tmp: true
  sequence: ALA PRO SER ARG LYS ASP GLU GLY GLY ALA

Command line

leap_build_linear_structure --config config_leap_build_linear_structure.yml --output_pdb_path structure.pdb

JSON

Common config file

{
  "properties": {
    "sequence": "ALA PRO SER ARG LYS ASP GLU GLY GLY ALA",
    "build_library": false,
    "forcefield": [
      "protein.ff14SB"
    ],
    "remove_tmp": true
  }
}

Command line

leap_build_linear_structure --config config_leap_build_linear_structure.json --output_pdb_path structure.pdb

Leap_solvate

Wrapper of the AmberTools (AMBER MD Package) leap tool module.

Get help

Command:

leap_solvate -h
usage: leap_solvate [-h] [--config CONFIG] --input_pdb_path INPUT_PDB_PATH [--input_lib_path INPUT_LIB_PATH] [--input_frcmod_path INPUT_FRCMOD_PATH] [--input_params_path INPUT_PARAMS_PATH] [--input_source_path INPUT_SOURCE_PATH] --output_pdb_path OUTPUT_PDB_PATH --output_top_path OUTPUT_TOP_PATH --output_crd_path OUTPUT_CRD_PATH

Generating and solvating a system box for an AMBER MD system. using tLeap program from AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_pdb_path INPUT_PDB_PATH
                        Input 3D structure PDB file. Accepted formats: pdb.
  --input_lib_path INPUT_LIB_PATH
                        Input ligand library parameters file. Accepted formats: lib, zip.
  --input_frcmod_path INPUT_FRCMOD_PATH
                        Input ligand frcmod parameters file. Accepted formats: frcmod, zip.
  --input_params_path INPUT_PARAMS_PATH
                        Additional leap parameter files to load with loadAmberParams Leap command. Accepted formats: leapin, in, txt, zip.
  --input_source_path INPUT_SOURCE_PATH
                        Additional leap command files to load with source Leap command. Accepted formats: leapin, in, txt, zip.
  --output_pdb_path OUTPUT_PDB_PATH
                        Output 3D structure PDB file matching the topology file. Accepted formats: pdb.
  --output_top_path OUTPUT_TOP_PATH
                        Output topology file (AMBER ParmTop). Accepted formats: top.
  --output_crd_path OUTPUT_CRD_PATH
                        Output coordinates file (AMBER crd). Accepted formats: crd.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_pdb_path (string): Input 3D structure PDB file. File type: input. Sample file. Accepted formats: PDB

  • input_lib_path (string): Input ligand library parameters file. File type: input. Sample file. Accepted formats: LIB, ZIP

  • input_frcmod_path (string): Input ligand frcmod parameters file. File type: input. Sample file. Accepted formats: FRCMOD, ZIP

  • input_params_path (string): Additional leap parameter files to load with loadAmberParams Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP

  • input_source_path (string): Additional leap command files to load with source Leap command. File type: input. Sample file. Accepted formats: IN, LEAPIN, TXT, ZIP

  • output_pdb_path (string): Output 3D structure PDB file matching the topology file. File type: output. Sample file. Accepted formats: PDB

  • output_top_path (string): Output topology file (AMBER ParmTop). File type: output. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

  • output_crd_path (string): Output coordinates file (AMBER crd). File type: output. Sample file. Accepted formats: CRD, MDCRD, INPCRD

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • forcefield (array): ([protein.ff14SB,DNA.bsc1,gaff]) Forcefield to be used for the structure generation. .

  • water_type (string): (TIP3PBOX) Water molecule parameters to be used for the topology. .

  • box_type (string): (truncated_octahedron) Type for the MD system box. .

  • ions_type (string): (ionsjc_tip3p) Ions type. .

  • neutralise (boolean): (False) Energetically neutralise the system adding the necessary counterions..

  • iso (boolean): (False) Make the box isometric..

  • positive_ions_number (integer): (0) Number of additional positive ions to include in the system box..

  • negative_ions_number (integer): (0) Number of additional negative ions to include in the system box..

  • positive_ions_type (string): (Na+) Type of additional positive ions to include in the system box. .

  • negative_ions_type (string): (Cl-) Type of additional negative ions to include in the system box. .

  • distance_to_molecule (number): (8.0) Size for the MD system box -in Angstroms-, defined such as the minimum distance between any atom originally present in solute and the edge of the periodic box is given by this distance parameter..

  • closeness (number): (1.0) How close, in Å, solvent ATOMs may come to solute ATOMs..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  box_type: truncated_octahedron
  distance_to_molecule: '9.0'
  forcefield:
  - protein.ff14SB
  remove_tmp: true
  water_type: TIP3PBOX

Command line

leap_solvate --config config_leap_solvate.yml --input_pdb_path structure.leap.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.solv.pdb --output_top_path structure.solv.top --output_crd_path structure.solv.crd

JSON

Common config file

{
  "properties": {
    "forcefield": [
      "protein.ff14SB"
    ],
    "water_type": "TIP3PBOX",
    "distance_to_molecule": "9.0",
    "box_type": "truncated_octahedron",
    "remove_tmp": true
  }
}

Command line

leap_solvate --config config_leap_solvate.json --input_pdb_path structure.leap.pdb --input_lib_path ligand.lib --input_frcmod_path ligand.frcmod --input_params_path frcmod.ionsdang_spce.txt --input_source_path leaprc.water.spce.txt --output_pdb_path structure.solv.pdb --output_top_path structure.solv.top --output_crd_path structure.solv.crd

Amber_to_pdb

Wrapper of the AmberTools (AMBER MD Package) ambpdb tool module.

Get help

Command:

amber_to_pdb -h
usage: amber_to_pdb [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --input_crd_path INPUT_CRD_PATH --output_pdb_path OUTPUT_PDB_PATH

Generates a PDB structure from AMBER topology (parmtop) and coordinates (crd) files, using the ambpdb tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        AMBER topology file. Accepted formats: top, parmtop, prmtop.
  --input_crd_path INPUT_CRD_PATH
                        AMBER coordinates file. Accepted formats: crd, mdcrd, inpcrd.
  --output_pdb_path OUTPUT_PDB_PATH
                        Structure PDB file. Accepted formats: pdb.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_top_path (string): AMBER topology file. File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

  • input_crd_path (string): AMBER coordinates file. File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD, RST

  • output_pdb_path (string): Structure PDB file. File type: output. Sample file. Accepted formats: PDB

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  remove_tmp: true

Command line

amber_to_pdb --config config_amber_to_pdb.yml --input_top_path structure.leap.top --input_crd_path structure.leap.crd --output_pdb_path structure.ambpdb.pdb

JSON

Common config file

{
  "properties": {
    "remove_tmp": true
  }
}

Command line

amber_to_pdb --config config_amber_to_pdb.json --input_top_path structure.leap.top --input_crd_path structure.leap.crd --output_pdb_path structure.ambpdb.pdb

Cpptraj_randomize_ions

Wrapper of the AmberTools (AMBER MD Package) cpptraj tool module.

Get help

Command:

cpptraj_randomize_ions -h
usage: cpptraj_randomize_ions [-h] [--config CONFIG] --input_top_path INPUT_TOP_PATH --input_crd_path INPUT_CRD_PATH --output_pdb_path OUTPUT_PDB_PATH --output_crd_path OUTPUT_CRD_PATH

Swap specified ions with randomly selected solvent molecules using cpptraj tool from the AmberTools MD package.

optional arguments:
  -h, --help            show this help message and exit
  --config CONFIG       Configuration file

required arguments:
  --input_top_path INPUT_TOP_PATH
                        Input topology file (AMBER ParmTop). Accepted formats: top, parmtop, prmtop.
  --input_crd_path INPUT_CRD_PATH
                        Input coordinates file (AMBER crd). Accepted formats: crd, mdcrd, inpcrd.
  --output_pdb_path OUTPUT_PDB_PATH
                        Structure PDB file with randomized ions. Accepted formats: pdb.
  --output_crd_path OUTPUT_CRD_PATH
                        Structure CRD file with coordinates including randomized ions. Accepted formats: crd, mdcrd, inpcrd.

I / O Arguments

Syntax: input_argument (datatype) : Definition

Config input / output arguments for this building block:

  • input_top_path (string): Input topology file (AMBER ParmTop). File type: input. Sample file. Accepted formats: TOP, PARMTOP, PRMTOP

  • input_crd_path (string): Input coordinates file (AMBER crd). File type: input. Sample file. Accepted formats: CRD, MDCRD, INPCRD

  • output_pdb_path (string): Structure PDB file with randomized ions. File type: output. Sample file. Accepted formats: PDB

  • output_crd_path (string): Structure CRD file with coordinates including randomized ions. File type: output. Sample file. Accepted formats: CRD, MDCRD, INPCRD

Config

Syntax: input_parameter (datatype) - (default_value) Definition

Config parameters for this building block:

  • ion_mask (string): (:K+,Cl-,Na+) Ions to be randomized. Cpptraj mask syntax can be found at the official Cpptraj manual..

  • solute_mask (string): (:DA,DC,DG,DT,D?3,D?5) Solute (or set of atoms) around which the ions can get no closer than the distance specified. Cpptraj mask syntax can be found at the official Cpptraj manual..

  • distance (number): (5.0) Minimum distance cutoff for the ions around the defined solute..

  • overlap (number): (3.5) Minimum distance between ions..

  • remove_tmp (boolean): (True) Remove temporal files..

  • restart (boolean): (False) Do not execute if output files exist..

YAML

Common config file

properties:
  remove_tmp: true

Command line

cpptraj_randomize_ions --config config_cpptraj_randomize_ions.yml --input_top_path structure.ions.parmtop --input_crd_path structure.ions.crd --output_pdb_path structure.randIons.pdb --output_crd_path structure.randIons.crd

JSON

Common config file

{
  "properties": {
    "remove_tmp": true
  }
}

Command line

cpptraj_randomize_ions --config config_cpptraj_randomize_ions.json --input_top_path structure.ions.parmtop --input_crd_path structure.ions.crd --output_pdb_path structure.randIons.pdb --output_crd_path structure.randIons.crd