nab package
Submodules
nab.nab_build_dna_structure module
Module containing the NabBuildDNAStructure class and the command line interface.
- class nab.nab_build_dna_structure.NabBuildDNAStructure(output_pdb_path, properties, **kwargs)[source]
Bases:
BiobbObject
biobb_amber.nab.nab_build_dna_structure NabBuildDNAStructureWrapper of the AmberTools (AMBER MD Package) nab tool module.Builds a 3D structure from a DNA sequence using nab (Nucleic Acid Builder) tool from the AmberTools MD package.- Parameters
output_pdb_path (str) – DNA 3D structure PDB file. File type: output. Sample file. Accepted formats: pdb (edam:format_1476).
properties (dic - Python dictionary object containing the tool parameters, not input/output files) –
sequence (str) - (“GCGCGGCTGATAAACGAAAGC”) Nucleotide sequence to convert to a 3D structure. Nucleotides should be written in 1-letter code, with no spaces between them.
helix_type (str) - (“lbdna”) DNA/RNA helix type. Values: arna (Right Handed A-RNA - Arnott), aprna (Right Handed A’-RNA - Arnott), lbdna (Right Handed B-DNA - Langridge), abdna (Right Handed B-DNA - Arnott), sbdna (Left Handed B-DNA - Sasisekharan), adna (Right Handed A-DNA - Arnott).
compiler (str) - (“gcc”) Alternative C compiler for nab.
linker (str) - (“gfortran”) Alternative Fortran linker for nab.
binary_path (str) - (“nab”) Path to the nab executable binary.
remove_tmp (bool) - (True) [WF property] Remove temporal files.
restart (bool) - (False) [WF property] Do not execute if output files exist.
container_path (str) - (None) Container path definition.
container_image (str) - (‘afandiadib/ambertools:serial’) Container image definition.
container_volume_path (str) - (‘/tmp’) Container volume path definition.
container_working_dir (str) - (None) Container working directory definition.
container_user_id (str) - (None) Container user_id definition.
container_shell_path (str) - (‘/bin/bash’) Path to default shell inside the container.
Examples
This is a use example of how to use the building block from Python:
from biobb_amber.nab.nab_build_dna_structure import nab_build_dna_structure prop = { 'sequence': 'GCGCGGCTGATAAACGAAAGC' } nab_build_dna_structure(output_pdb_path='/path/to/newStructure.pdb', properties=prop)
- Info:
- wrapped_software:
name: AmberTools nab
version: >20.9
license: LGPL 2.1
- ontology:
name: EDAM
schema: http://edamontology.org/EDAM.owl